Anti-salbutamol and/or clenbuterol monoclonal antibody and application
A monoclonal antibody, albuterol technology, applied in the application, specific peptides, chemical instruments and methods, etc., can solve the problems of low affinity restricting applications, etc., and achieve the effect of high sensitivity, high affinity, and good cross-reaction rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Preparation of monoclonal antibody against albuterol / clenbuterol
[0026] 1. Use the albuterol hapten in the phage antibody library to undergo four rounds of "adsorption-elution-amplification" enrichment screening to obtain the anti-salbutamol single-chain (scFv) antibody, and then obtain the antibody variable by PCR amplification and sequencing. The region sequences are respectively the light chain variable region sequence SEQ ID NO.3 and the heavy chain variable region sequence SEQ ID NO.4, and the clone with the highest affinity is the 4D6 cell line.
[0027] 2. According to the light chain and heavy chain variable region sequences obtained in step 1, design primers. The sequences of the primers are as follows:
[0028] Heavy chain primer:
[0029] Forward: accagggtgctgagtcaggtgcagctgcagcagag (shown in SEQ ID NO.13);
[0030] Reverse: gcccttggtgctagcggcgctcacggtcaccaggg (shown in SEQ ID NO.14);
[0031] Light chain primer:
[0032] Forward: acaggagtgca...
Embodiment 2
[0046] Example 2: Homology modeling and molecular docking of anti-salbutamol monoclonal antibody
[0047] The 3D structure of the 4D6 monoclonal antibody was predicted by Robetta (https: / / robetta.bakerlab.org / ) using default parameters. AutoDock Vina was selected as the molecular docking tool. Use MGLTooLs1.5.6 to read in the 4D6 structure, and perform hydrogenation and Kollman charge operations to generate the protein.pdbqt file. The docking box center is set to the geometric center of the CDR ring, and the box size is set to so that it contains the entire CDR domain. The 3D structure of SAL in sdf format was downloaded from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / compound / Salbutamol) and converted to a mol2 file using OpenBabel. MGLTools is used to generate the ligand pdbqt file. The ligand_prepare.py script in the molecular docking software package is used to process the mol2 file of the ligand linoleic acid. The default method is used to set the flexible bond, give G...
Embodiment 3
[0049] Example 3: Affinity Maturation Assay for Monoclonal Antibodies
[0050] In the combination of antibody and antigen, the CDR region in the antibody structure, especially the heavy chain CDR3 and light chain CDR3 play the most important role. According to the above computer molecular simulation analysis results, SER98, GLN99, and SER100 in the CDR3 region of the heavy chain, and PHE213, SER216, VAL218, and PHE220 in the CDR3 region of the light chain play the most important role in the binding of monoclonal antibodies to salbutamol. Guided by this analysis, the amino acid residues within 50nm around the albuterol molecule were selected as mutation target sites, and a total of 10 amino acid residues were selected. Design degenerate primers based on known antibody gene sequences, and introduce mutations at the target sites in the single-chain antibody by PCR technology. In order to avoid too many inactive clones, the adjusted NNS degenerate codons were used to introduce mu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


