Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-salbutamol and/or clenbuterol monoclonal antibody and application

A monoclonal antibody, albuterol technology, applied in the application, specific peptides, chemical instruments and methods, etc., can solve the problems of low affinity restricting applications, etc., and achieve the effect of high sensitivity, high affinity, and good cross-reaction rate.

Pending Publication Date: 2022-05-06
JIANGSU UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the immunoassay method is the fastest and most economical, but the antibodies currently used in immunoassays are mainly polyclonal antibodies, and their low affinity limits their application in immunoassays

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-salbutamol and/or clenbuterol monoclonal antibody and application
  • Anti-salbutamol and/or clenbuterol monoclonal antibody and application
  • Anti-salbutamol and/or clenbuterol monoclonal antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Preparation of monoclonal antibody against albuterol / clenbuterol

[0026] 1. Use the albuterol hapten in the phage antibody library to undergo four rounds of "adsorption-elution-amplification" enrichment screening to obtain the anti-salbutamol single-chain (scFv) antibody, and then obtain the antibody variable by PCR amplification and sequencing. The region sequences are respectively the light chain variable region sequence SEQ ID NO.3 and the heavy chain variable region sequence SEQ ID NO.4, and the clone with the highest affinity is the 4D6 cell line.

[0027] 2. According to the light chain and heavy chain variable region sequences obtained in step 1, design primers. The sequences of the primers are as follows:

[0028] Heavy chain primer:

[0029] Forward: accagggtgctgagtcaggtgcagctgcagcagag (shown in SEQ ID NO.13);

[0030] Reverse: gcccttggtgctagcggcgctcacggtcaccaggg (shown in SEQ ID NO.14);

[0031] Light chain primer:

[0032] Forward: acaggagtgca...

Embodiment 2

[0046] Example 2: Homology modeling and molecular docking of anti-salbutamol monoclonal antibody

[0047] The 3D structure of the 4D6 monoclonal antibody was predicted by Robetta (https: / / robetta.bakerlab.org / ) using default parameters. AutoDock Vina was selected as the molecular docking tool. Use MGLTooLs1.5.6 to read in the 4D6 structure, and perform hydrogenation and Kollman charge operations to generate the protein.pdbqt file. The docking box center is set to the geometric center of the CDR ring, and the box size is set to so that it contains the entire CDR domain. The 3D structure of SAL in sdf format was downloaded from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / compound / Salbutamol) and converted to a mol2 file using OpenBabel. MGLTools is used to generate the ligand pdbqt file. The ligand_prepare.py script in the molecular docking software package is used to process the mol2 file of the ligand linoleic acid. The default method is used to set the flexible bond, give G...

Embodiment 3

[0049] Example 3: Affinity Maturation Assay for Monoclonal Antibodies

[0050] In the combination of antibody and antigen, the CDR region in the antibody structure, especially the heavy chain CDR3 and light chain CDR3 play the most important role. According to the above computer molecular simulation analysis results, SER98, GLN99, and SER100 in the CDR3 region of the heavy chain, and PHE213, SER216, VAL218, and PHE220 in the CDR3 region of the light chain play the most important role in the binding of monoclonal antibodies to salbutamol. Guided by this analysis, the amino acid residues within 50nm around the albuterol molecule were selected as mutation target sites, and a total of 10 amino acid residues were selected. Design degenerate primers based on known antibody gene sequences, and introduce mutations at the target sites in the single-chain antibody by PCR technology. In order to avoid too many inactive clones, the adjusted NNS degenerate codons were used to introduce mu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of antibodies, and particularly relates to an anti-salbutamol and / or clenbuterol monoclonal antibody and application thereof. The antibody comprises a light chain variable region, and the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO.3, or a conservative variant obtained by conservative mutation of the amino acid sequence as shown in SEQ ID NO.3 through addition, deletion, replacement and modification of one or more amino acids; the heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO.4, or is a conservative variant obtained by conservative mutation of the amino acid sequence as shown in SEQ ID NO.4 through addition, deletion, replacement and modification of one or more amino acids. The monoclonal antibody provided by the invention has good cross reaction rate, high affinity and high sensitivity to salbutamol and clenbuterol, and is suitable for rapid immunodetection of salbutamol and clenbuterol.

Description

technical field [0001] The invention belongs to the technical field of antibodies, in particular to a monoclonal antibody against albuterol and / or clenbuterol and its application. Background technique [0002] Salbutamol (SAL) and clenbuterol belong to β-agonist (β-agonist), the full name of β-adrenoceptor agonist (β-adrenoceptor agonist), is a kind of chemical structure and physiological function similar to adrenaline and norepinephrine Phenylethylamines (phenethylamines, PEAs) of epinephrine. β-agonists can selectively bind to β-adrenergic receptors on the cell membrane to regulate sympathetic nerve excitation and relax tracheal smooth muscle. Therefore, they are often used clinically in the treatment of asthma-like diseases in humans and animals. When the dosage of β-agonist is 5-10 times of the clinical dosage, it can enhance fat catabolism in the body, increase protein synthesis and reduce adipose tissue, and significantly increase the lean meat rate. Clenbuterol was ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/44C12N15/13G01N33/577G01N33/53
CPCC07K16/44G01N33/577G01N33/5308C07K2317/56C07K2317/52
Inventor 杨广博刘明刘斌孔韧常珊
Owner JIANGSU UNIV OF TECH