Fluorescent reporter gene element, gene editing monitoring system and application thereof
A fluorescent reporter gene and gene element technology, applied in the field of genetic engineering, to avoid the restrictions of medical ethics and overcome the problems of time and economic cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0077] According to a typical embodiment of the present invention, the fluorescent reporter gene element further includes a first cutting element, a second cutting element, a third cutting element and a fourth cutting element, the first fluorescent protein reporter gene and the first cutting element The element is located in the first coding region, the second cutting element, the second fluorescent protein reporter gene and the third cutting element are located in the second coding region, the fourth cutting element and the third fluorescent protein reporter gene are located in the Describe the third coding region. The first coding region includes a sequentially connected first fluorescent protein reporter gene and a first cutting element, and the second coding region includes a sequentially connected second cutting element, a second fluorescent protein reporter gene and a third cutting element , the third coding region includes the fourth cutting element and the third fluore...
Embodiment 1
[0116] The construction of embodiment 1 fluorescent reporter element (TFRS)
[0117] In the examples of this application, a fluorescent reporter gene element was synthesized using a promoter, a fluorescent protein reporter gene and a cleavage element, labeled as TFRS. Including the following steps:
[0118] 1. Construction of fluorescent reporter gene element (TFRS)
[0119] The promoter in the fluorescent reporter gene element, the first fluorescent protein reporter gene (yellow fluorescent protein gene TopzaYFP), the second fluorescent protein reporter gene (red fluorescent protein gene mCherry) and the third fluorescent protein reporter gene (blue fluorescent protein gene TagBFP ) sequence information comes from the NCBI database, and the synthesis is completed by Sangon Bioengineering (Shanghai) Co., Ltd.; the yellow fluorescent protein gene TopzaYFP and the red fluorescent protein gene mCherry are connected with a first cutting element and a second cutting element, and t...
Embodiment 2
[0146] The detection and verification of embodiment 2 fluorescent reporter element (TFRS)
[0147] In this example, in order to verify whether the fluorescent reporter gene has the corresponding function, the present invention uses a positive quality control fragment for verification, using GGAATCCCTTCTGCAGCACCCGG as the positive quality control fragment, labeled as a T+0 fragment; inserting 1 base into the positive quality control fragment The fragment obtained by inserting 2 bases into the positive quality control fragment is marked as T+1 fragment; the fragment obtained by inserting 2 bases into the positive quality control fragment is marked as T+2 fragment GGAATCCCTTCTGCAGaCACCCGG, and the T+0 fragment, T+1 fragment and T+2 The fragments were respectively inserted into the fluorescent reporter gene elements constructed in Example 1, and the obtained fluorescent reporter gene elements were respectively labeled as Positive control T+0 fragment, Positive control T+1 fragment ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


