Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent reporter gene element, gene editing monitoring system and application thereof

A fluorescent reporter gene and gene element technology, applied in the field of genetic engineering, to avoid the restrictions of medical ethics and overcome the problems of time and economic cost

Active Publication Date: 2022-05-10
SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these machine learning models each use different data sets for training, therefore, each prediction model is only applicable to the prediction of the outcome of gene editing in specific target regions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent reporter gene element, gene editing monitoring system and application thereof
  • Fluorescent reporter gene element, gene editing monitoring system and application thereof
  • Fluorescent reporter gene element, gene editing monitoring system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0077] According to a typical embodiment of the present invention, the fluorescent reporter gene element further includes a first cutting element, a second cutting element, a third cutting element and a fourth cutting element, the first fluorescent protein reporter gene and the first cutting element The element is located in the first coding region, the second cutting element, the second fluorescent protein reporter gene and the third cutting element are located in the second coding region, the fourth cutting element and the third fluorescent protein reporter gene are located in the Describe the third coding region. The first coding region includes a sequentially connected first fluorescent protein reporter gene and a first cutting element, and the second coding region includes a sequentially connected second cutting element, a second fluorescent protein reporter gene and a third cutting element , the third coding region includes the fourth cutting element and the third fluore...

Embodiment 1

[0116] The construction of embodiment 1 fluorescent reporter element (TFRS)

[0117] In the examples of this application, a fluorescent reporter gene element was synthesized using a promoter, a fluorescent protein reporter gene and a cleavage element, labeled as TFRS. Including the following steps:

[0118] 1. Construction of fluorescent reporter gene element (TFRS)

[0119] The promoter in the fluorescent reporter gene element, the first fluorescent protein reporter gene (yellow fluorescent protein gene TopzaYFP), the second fluorescent protein reporter gene (red fluorescent protein gene mCherry) and the third fluorescent protein reporter gene (blue fluorescent protein gene TagBFP ) sequence information comes from the NCBI database, and the synthesis is completed by Sangon Bioengineering (Shanghai) Co., Ltd.; the yellow fluorescent protein gene TopzaYFP and the red fluorescent protein gene mCherry are connected with a first cutting element and a second cutting element, and t...

Embodiment 2

[0146] The detection and verification of embodiment 2 fluorescent reporter element (TFRS)

[0147] In this example, in order to verify whether the fluorescent reporter gene has the corresponding function, the present invention uses a positive quality control fragment for verification, using GGAATCCCTTCTGCAGCACCCGG as the positive quality control fragment, labeled as a T+0 fragment; inserting 1 base into the positive quality control fragment The fragment obtained by inserting 2 bases into the positive quality control fragment is marked as T+1 fragment; the fragment obtained by inserting 2 bases into the positive quality control fragment is marked as T+2 fragment GGAATCCCTTCTGCAGaCACCCGG, and the T+0 fragment, T+1 fragment and T+2 The fragments were respectively inserted into the fluorescent reporter gene elements constructed in Example 1, and the obtained fluorescent reporter gene elements were respectively labeled as Positive control T+0 fragment, Positive control T+1 fragment ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent reporter gene element, a gene editing monitoring system and application. The gene element comprises a first coding region, a second coding region and a third coding region which are connected in sequence; the first coding region comprises a first fluorescent protein reporter gene, the second coding region comprises a second fluorescent protein reporter gene, and the third coding region comprises a third fluorescent protein reporter gene; the first fluorescent protein reporter gene, the second fluorescent protein reporter gene and the third fluorescent protein reporter gene are respectively positioned in different reading frames, so that only one fluorescent protein can be correctly expressed. According to the gene element, the target DNA editing result is monitored in real time, and the optimal editing time window can be determined; and completing prediction of a target DNA editing result by counting the number of different fluorescent light-emitting cells. In addition, by establishing a humanized cell model, evaluation of a new gene therapy technology of diseases can be carried out.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a fluorescent reporter gene element, a gene editing monitoring system and applications thereof. Background technique [0002] Since the CRISPR-Cas9 system was first successfully used for gene editing in mammalian cells in 2013 (Cong et al., 2013; Mali et al., 2013), scientists from all over the world have actively explored the application of this technology in the field of gene function research and gene therapy (Gao et al., 2018; Kuscu et al., 2017; Lee et al., 2019; Levy et al., 2020; Li et al., 2018; Liang et al., 2017; Liu et al., 2018; Rossidis et al., 2018; Ryu et al., 2018; Song et al., 2020; Villiger et al., 2018; Zeng et al., 2018). For example, non-homologous end joining (NHEJ) induced by CRISPR-Cas9 can artificially create loss of protein function, or cause nonsense mutations through premature termination of codons. The above-mentioned targeted editing of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/65C12N15/113C12N9/22G01N21/64
CPCC12N15/86C12N15/65C12N9/22C12N15/113G01N21/6428C12N2310/20C12N2800/30C12N2740/15043
Inventor 索伦吴海波边雪娇张硕吕祁峰匡延平
Owner SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE