Supercharge Your Innovation With Domain-Expert AI Agents!

TaqDNA polymerase mutant

A polymerase and nucleic acid technology, applied in the biological field, can solve problems such as the unsatisfactory effect of resistance to inhibition and the high amount of templates

Pending Publication Date: 2022-05-13
XIAMEN UNIV +1
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still more or less problems in these mutants, such as the high amount of template required, or the effect of resistance to inhibition cannot reach the ideal state

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TaqDNA polymerase mutant
  • TaqDNA polymerase mutant
  • TaqDNA polymerase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The acquisition of embodiment 1-Taq 01 DNA polymerase mutant

[0057] In this embodiment, a CSR high-throughput screening system is first established, and a mutant library is obtained by error-prone PCR, and then the mutant library is subjected to emulsification PCR and the extension time and cycle number are reduced during the PCR process (see figure 1 ).

[0058] In the fifth round of the library, 6 clones were randomly selected, and the activity of the crude enzyme was detected by inducing the bacteria to produce crude enzymes, and the mutation was identified by sequencing. It was found that in this case, the wild-type bacteria could not amplify the 2500bp band and the The amplified band of Taq 01 indicates that it has excellent activity (see figure 2 ). Therefore, it was purified together with WT and E507K and tested for activity.

Embodiment 2

[0059] Embodiment 2-PCR detects mutant to SYBR Green Tolerance of I

[0060] The mouse genome was used as a template in PCR detection of the mutant's tolerance to SYBR Green I, and primers that could amplify 1kb DNA were designed. The primer sequence is F: gcagatagggaaatggggctcctga (SEQ ID NO: 3), R: tcagcaagacctgcgtaggcaacgg (SEQ ID NO: 4). Anti-tolerance was detected by the inhibition of Taq DNA polymerase by SYBR Green I. Set four SYBR Green concentration gradients of 0, 1:50, 1:25, and 1:12.5, respectively, and use Taq DNA polymerase and mutants to amplify a 1kb mouse genome fragment under these pressure conditions.

[0061] It was found that WT could not amplify the product or the amplified product band was weak under the condition of SYBR Green 1:50, while E507K and Taq 01 could amplify the product under the condition of SYBR Green 1:50 and the band was relatively weak. bright, and the Taq 01 mutant has a weak band under the condition of SYBR Green 1:12.5, while E5...

Embodiment 3-q

[0066] Example 3-qPCR two-step method detects rapid PCR and tolerance to SYBRGreenI activity

[0067] In the qPCR two-step detection method, the human cell genome was used as a template, and primers capable of amplifying 148bp DNA were designed. The primer sequence is F: aaagccgctcaactacatgg (SEQ ID NO: 5), R: tgctttgaatgcgtcccagag (SEQ ID NO: 6). SYBR Green I dye was used to detect product formation during qPCR. Different annealing times and template amounts were set during the qPCR two-step method.

[0068] The results showed that the Taq 01 DNA polymerase mutant, WT and E507K could amplify the product regardless of the amount of template when the extension time was 1 min, and the CT values ​​were similar. But when the extension time was reduced to 10sec, WT could not amplify the product, but other E507K and Taq 01 could amplify the product. And among them, the Taq 01 mutant performed superiorly, and the CT value of the E507K mutant reported in the literature was about ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Taq DNA (Deoxyribose Nucleic Acid) polymerase mutant which can be used for carrying out rapid PCR (Polymerase Chain Reaction) and is tolerant to SYBR Green I. The Taq 01 DNA polymerase mutant obtained by screening in the invention shows rapid PCR (Polymerase Chain Reaction) activity in PCR (Polymerase Chain Reaction) and qPCR (Quantitative Polymerase Chain Reaction) and is more tolerant to SYBR Green I activity. Based on the advantages, the mutant can be subjected to rapid PCR (Polymerase Chain Reaction) in the presence of inhibitors such as SYBR Green I and the like, so that a result can be obtained more rapidly and sensitively in clinical diagnosis and scientific research.

Description

technical field [0001] The invention relates to the field of biology, and specifically relates to a Taq DNA polymerase mutant. Background technique [0002] Polymerase chain reaction (PCR) is a widely used technique for amplifying DNA in vitro. Since PCR came out in 1985, it has gradually expanded to various fields. In addition to being used in laboratory molecular biology, it also plays a very important role in clinical disease diagnosis and forensic identification. For example, the detection of gene mutations and microbial or viral infection factors, etc., can also further detect antibiotic resistance genes and biological threat agents. One of the earliest diagnostic uses of PCR was as a prenatal diagnostic test for sickle cell anemia. Detection of sickle cell mutations using PCR is faster and more sensitive than previous methods. More PCR-based diagnostics followed, including detection of low-copy-number viral targets such as HIV; tests for the diagnosis of tuberculos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12Q1/686
CPCC12N9/1252C12Q1/686C12Y207/07007C12Q2521/101C12Q2563/107
Inventor 张永有郑华雷刘本超宋娜杰
Owner XIAMEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More