Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method
A nuclear polyhedron and promoter sequence technology is applied in the fields of molecular biology and bioengineering, and can solve the problems of inability to express foreign genes, inability of recombinant viruses to infect insects, and difficulty in determining the infection of cells by recombinant viruses.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0012] Below in conjunction with accompanying drawing, the present invention is described in further detail:
[0013] According to Figure 1, figure 2 , image 3 It can be seen that the polyhedron gene with promoter sequence is amplified from the genome of HaSNPV by using a pair of upstream and downstream primers specific to the polyhedrosis gene of cotton bollworm mononuclear polyhedrosis virus (HaSNPV).
[0014] Primer sequence: Ph-1 CGGATCCCTTATACTTCTAAACTGTTCGTCGTC
[0015] Ph-2 CGTATACTTAATATGCAGGACCAGTGTATAG; Using a pair of upstream and downstream primers specific to the P10 promoter of cotton bollworm mononuclear polyhedrosis virus (HaSNPV), the HaP10 promoter sequence was amplified from the HaSNPV genome.
[0016] Primer sequence: P10-1 AGATCTCGAAACCTGACACGAAACG
[0017] P10-2 GGATCCCGTGATTATTTCGTCGTACAGTTGG; clone the two into the pGEMT-ease vector respectively to obtain pGEMTP10 and pGEMTPh plasmids; cut the pGEMTP10 plasmid with Pst I and Bgl ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com