Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method

A nuclear polyhedron and promoter sequence technology is applied in the fields of molecular biology and bioengineering, and can solve the problems of inability to express foreign genes, inability of recombinant viruses to infect insects, and difficulty in determining the infection of cells by recombinant viruses.

Inactive Publication Date: 2003-07-16
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the shuttle expression vector is an incomplete virus lacking the polyhedron gene, so the virus can only be produced in the cell, and it is not easy to determine whether the cell is i

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method
  • Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method
  • Fast donor plasmid carrying cotton bollworm single particle embedded nuclear polyhedrosis virus gene and P10 gene promotor sequence and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] Below in conjunction with accompanying drawing, the present invention is described in further detail:

[0013] According to Figure 1, figure 2 , image 3 It can be seen that the polyhedron gene with promoter sequence is amplified from the genome of HaSNPV by using a pair of upstream and downstream primers specific to the polyhedrosis gene of cotton bollworm mononuclear polyhedrosis virus (HaSNPV).

[0014] Primer sequence: Ph-1 CGGATCCCTTATACTTCTAAACTGTTCGTCGTC

[0015] Ph-2 CGTATACTTAATATGCAGGACCAGTGTATAG; Using a pair of upstream and downstream primers specific to the P10 promoter of cotton bollworm mononuclear polyhedrosis virus (HaSNPV), the HaP10 promoter sequence was amplified from the HaSNPV genome.

[0016] Primer sequence: P10-1 AGATCTCGAAACCTGACACGAAACG

[0017] P10-2 GGATCCCGTGATTATTTCGTCGTACAGTTGG; clone the two into the pGEMT-ease vector respectively to obtain pGEMTP10 and pGEMTPh plasmids; cut the pGEMTP10 plasmid with Pst I and Bgl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A fast doner plasmid with singly embedded polyhedronvirus gene of bollworm and P10 gene promoter sequence is configured through inserting exogenous gene in polycloning site under control of P10, transfecting it to bollworm cell by inserting the exogenous gene and polyhydrous gene in the shuttle expression carrier, collecting recombinant virus particles, transfecting again, and detecting the exogenous gene expression level. Its advantages is short period (7-14 days).

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and bioengineering, and specifically relates to a rapid donor plasmid with single-grain embedded nuclear polyhedrosis virus gene of cotton bollworm and P10 gene promoter sequence, and also relates to a construction method of the plasmid. Background technique [0002] Baculoviruses are widely used in biological control of agricultural and forestry pests. At the same time, the baculovirus-insect (cell) system is also a very good eukaryotic expression system, which has been used in the research and production of foreign genes, diagnostic reagents and vaccines. Like other baculoviruses, Chinese cotton bollworm single nucleocapsid nucleopolyhedrovims (Helicoverpaarmigera single nucleocapsid nucleopolyhedrovims, hereinafter referred to as wild-type virus or HaSNPV) as an insecticide has the disadvantage of slow insecticidal speed, resulting in a large area The role...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A01N63/00C12N7/01C12N15/33C12N15/79
Inventor 王汉中陈新文胡志红
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap