Relativity of proangiotension transferase 2 gene and prinary hypertension
A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unproven ACE2 gene SNP and essential hypertension, and unproven ACE2 gene and essential hypertension.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] 1 Objects and methods
[0065] 1.1 Research object
[0066] 1.1.1 Chinese SNP discovery and confirmation samples
[0067] The sample is 24 primary hypertension patients from 24 core Han hypertension families who are not related.
[0068] 1.1.2 SNP typing and association analysis research sample
[0069] All subjects are of Han nationality. There were 96 patients in the essential hypertension group (EH group) and the normal blood pressure group (NT group), both from Shanghai, China, and they were not related to each other. The EH group were inpatients in the Hypertension Department of Shanghai Ruijin Hospital, all of whom were of Han nationality and unrelated. A total of 390 people, with an average age of 57.32±11.75 years old. standard constrain:
[0070] The systolic blood pressure is 140mmHg and / or the diastolic blood pressure is 90mmHg, or is being treated with antihypertensive drugs for at least one year;
[0071] Except for those who have the disease before or after th...
Embodiment 2
[0106] Susceptibility auxiliary detection kit for essential hypertension
[0107] Prepare a kit containing:
[0108] Name Sequence (5’→3’) Number Concentration
[0109] Forward primer ctgttctgttccagggcttc SEQ ID NO: 30 Dry powder 20D
[0110] Reverse primer agtgtcacctgacccaagga SEQ ID NO: 31 dry powder 20D
[0111] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer
[0112] Take 3ml of blood from the male patient to be tested, and use conventional methods (or use a specific kit) to extract DNA from the blood. The PCR primers in the hypertension detection kit are diluted to 1μmol / μl, and the extracted DNA is used as a template to perform a PCR reaction with the provided primers. After the PCR product is purified, use ABI-PRISMTM 377 DNA sequencer to perform two-way sequencing with fluorescent labeled end termination method, and use Polyphred software for sequence interpretation and SNP confirmation. Test results figure 1 Shown. Among them, containing C...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com