Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Relativity of proangiotension transferase 2 gene and prinary hypertension

A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unproven ACE2 gene SNP and essential hypertension, and unproven ACE2 gene and essential hypertension.

Inactive Publication Date: 2006-01-25
SHANGHAI INST OF HYPERTENSION +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, some scholars have put forward the hypothetical mechanism of ACE2 gene regulating blood pressure, and believe that ACE2 may become an important target in cardiovascular treatment, but there is no report confirming the correlation between ACE2 gene and essential hypertension, let alone A report confirming the correlation between SNP of ACE2 gene and essential hypertension

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Relativity of proangiotension transferase 2 gene and prinary hypertension

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] 1 Objects and methods

[0065] 1.1 Research object

[0066] 1.1.1 Chinese SNP discovery and confirmation samples

[0067] The sample is 24 primary hypertension patients from 24 core Han hypertension families who are not related.

[0068] 1.1.2 SNP typing and association analysis research sample

[0069] All subjects are of Han nationality. There were 96 patients in the essential hypertension group (EH group) and the normal blood pressure group (NT group), both from Shanghai, China, and they were not related to each other. The EH group were inpatients in the Hypertension Department of Shanghai Ruijin Hospital, all of whom were of Han nationality and unrelated. A total of 390 people, with an average age of 57.32±11.75 years old. standard constrain:

[0070] The systolic blood pressure is 140mmHg and / or the diastolic blood pressure is 90mmHg, or is being treated with antihypertensive drugs for at least one year;

[0071] Except for those who have the disease before or after th...

Embodiment 2

[0106] Susceptibility auxiliary detection kit for essential hypertension

[0107] Prepare a kit containing:

[0108] Name Sequence (5’→3’) Number Concentration

[0109] Forward primer ctgttctgttccagggcttc SEQ ID NO: 30 Dry powder 20D

[0110] Reverse primer agtgtcacctgacccaagga SEQ ID NO: 31 dry powder 20D

[0111] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer

[0112] Take 3ml of blood from the male patient to be tested, and use conventional methods (or use a specific kit) to extract DNA from the blood. The PCR primers in the hypertension detection kit are diluted to 1μmol / μl, and the extracted DNA is used as a template to perform a PCR reaction with the provided primers. After the PCR product is purified, use ABI-PRISMTM 377 DNA sequencer to perform two-way sequencing with fluorescent labeled end termination method, and use Polyphred software for sequence interpretation and SNP confirmation. Test results figure 1 Shown. Among them, containing C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method to test essential hypertension susceptibility that includes ACE2 used to test individual, transcript and / or albumen comparing to normal to see whether variation exists. The invention also discloses the corresponding testing agent box.

Description

Technical field [0001] The invention relates to the fields of molecular biology and medicine. More specifically, it relates to the single nucleotide polymorphism (singlenucleotide polymorphism, SNP) of human angiotensin converting enzyme 2 gene (ACE2) and its correlation with essential hypertension. The present invention also relates to methods and kits for detecting these SNPs. Background technique [0002] Essential hypertension (EH) is the most common cardiovascular disease. Its incidence is increasing year by year, and it can cause serious heart, brain, and kidney complications. It is a major risk factor for stroke and coronary heart disease. EH is a polygenic disease caused by the interaction of genetic factors and environmental factors. Searching for EH-related genes to clarify the genetic mechanism of hypertension has become a hot research topic (HarrapSB. Hypertension: genes versus environment. Lancet, 1994, 344: 169-171). [0003] The renin-angiotensin (RAS) system is an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68A61K38/16A61K48/00A61P9/12
Inventor 张怡朱鼎良王谷亮高平进黄薇
Owner SHANGHAI INST OF HYPERTENSION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products