Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker of Wuzhishan pig and its application

A molecular marker, miniature pig technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., which can solve the problems of cumbersome experimental steps and many microsatellite DNA markers.

Active Publication Date: 2006-09-06
GRAND LIFE SCI & TECH
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above two methods can be used to identify species populations well, but they both have the disadvantages of requiring many microsatellite DNA markers and cumbersome experimental steps.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of Wuzhishan pig and its application
  • Molecular marker of Wuzhishan pig and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1, the acquisition of the molecular marker Sw936-88 of the present invention

[0020] Material

[0021] The research object WZSP inbred line is the 17th generation inbred line bred by two breeding pigs (one male and one female) by the Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences through high inbreeding. The ear tissue samples of the WZSP inbred line (110 heads) were collected from the Wuzhishan Pig Breeding Plant of the Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences, and the blood samples of Tongcheng pigs (100 heads) were collected from the Pig Breeding Plant of Tongcheng County Animal Husbandry Bureau, Hubei Province.

[0022] Primer

[0023] The primer for amplifying microsatellite locus Sw936 was synthesized by Shanghai Boya Biotechnology Co., Ltd., and its sequence is:

[0024] Forward primer: 5'TCTGGAGCTAGCATAAGTGCC 3' (SEQ ID NO: 2)

[0025] Reverse primer 5'GTGCAAGTACACATGCAGGG 3' (SEQ ID NO: 3)

[...

Embodiment 2

[0033] Example 2, the specificity of molecular marker Sw936-88

[0034] Extract Wuzhishan mini-pigs (100 heads) according to the method of embodiment 1, Duroc pigs (50 heads), Large White pigs (50 heads), Landrace pigs (50 heads), Dachangtong pigs (50 heads), Changtong pigs ( 50 heads), Genomic DNA of ear tissue samples of Xiang pigs (50 heads), Min pigs (50 heads), Korean Min pigs (50 heads) and Korean Large White pigs (50 heads), using primers: 5'TCTGGAGCTAGCATAAGTGCC 3'(sequence 2) and 5'GTGCAAGTACACATGCAGGG 3' (sequence 3) were amplified by PCR, and the amplified products were subjected to 15% non-denaturing polyacrylamide gel electrophoresis. The results showed that among the 100 Wuzhishan miniature pigs detected, 71 contained 88bp 50 Duroc pigs, 50 Large White pigs, 50 Landrace pigs, 50 Dachangtong pigs, 50 Changtong pigs, 50 Xiang pigs, 50 Min pigs, 50 Korean Min pigs and 50 South Korean Large White pigs did not have this band. According to the method of Example 1, al...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the labeled molecule and the method for identifying wu zhishann miniature pig with labeled molecule. The labeled molecule possesses the nucleic acid sequence 1 in sequence table. The method comprises the following steps: using the DNA of pig as mold, making the 2 nucleic acid sequence and 3 nucleic acid sequences carry out PCR augmentation, and checking that if there is 88bp strip in augmentation product. The invention lays the foundation of utilizing wu zhishann miniature pig inbred line.

Description

technical field [0001] The invention relates to a molecular marker of Wuzhishan mini-pig and its application, in particular to a method for identifying Wuzhishan mini-pig by using the molecular marker. Background technique [0002] Wuzhishan Miniature Pig (WZSP) is a well-known rare and endangered pig breed unique to my country. This breed originated in Wuzhishan District in the south-central part of Hainan Province. In the 1980s, there were only more than 10 of them, which were on the verge of extinction. After going through hardships, they were successfully preserved in different places in the Animal Husbandry Research Institute of the Chinese Academy of Agricultural Sciences, and were successfully bred into inbred lines. Because pigs and humans have great similarities in physiological anatomy, nutrient metabolism, biochemical indicators and other characteristics, especially the structure of the cardiovascular system is more similar to humans (Peter J.M et al.Xenotransplan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 冯书堂牟玉莲李奎张莉顾茂松李赞东姜盛花
Owner GRAND LIFE SCI & TECH