Molecular marker of Wuzhishan pig and its application
A molecular marker, miniature pig technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., which can solve the problems of cumbersome experimental steps and many microsatellite DNA markers.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1, the acquisition of the molecular marker Sw936-88 of the present invention
[0020] Material
[0021] The research object WZSP inbred line is the 17th generation inbred line bred by two breeding pigs (one male and one female) by the Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences through high inbreeding. The ear tissue samples of the WZSP inbred line (110 heads) were collected from the Wuzhishan Pig Breeding Plant of the Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences, and the blood samples of Tongcheng pigs (100 heads) were collected from the Pig Breeding Plant of Tongcheng County Animal Husbandry Bureau, Hubei Province.
[0022] Primer
[0023] The primer for amplifying microsatellite locus Sw936 was synthesized by Shanghai Boya Biotechnology Co., Ltd., and its sequence is:
[0024] Forward primer: 5'TCTGGAGCTAGCATAAGTGCC 3' (SEQ ID NO: 2)
[0025] Reverse primer 5'GTGCAAGTACACATGCAGGG 3' (SEQ ID NO: 3)
[...
Embodiment 2
[0033] Example 2, the specificity of molecular marker Sw936-88
[0034] Extract Wuzhishan mini-pigs (100 heads) according to the method of embodiment 1, Duroc pigs (50 heads), Large White pigs (50 heads), Landrace pigs (50 heads), Dachangtong pigs (50 heads), Changtong pigs ( 50 heads), Genomic DNA of ear tissue samples of Xiang pigs (50 heads), Min pigs (50 heads), Korean Min pigs (50 heads) and Korean Large White pigs (50 heads), using primers: 5'TCTGGAGCTAGCATAAGTGCC 3'(sequence 2) and 5'GTGCAAGTACACATGCAGGG 3' (sequence 3) were amplified by PCR, and the amplified products were subjected to 15% non-denaturing polyacrylamide gel electrophoresis. The results showed that among the 100 Wuzhishan miniature pigs detected, 71 contained 88bp 50 Duroc pigs, 50 Large White pigs, 50 Landrace pigs, 50 Dachangtong pigs, 50 Changtong pigs, 50 Xiang pigs, 50 Min pigs, 50 Korean Min pigs and 50 South Korean Large White pigs did not have this band. According to the method of Example 1, al...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

