Check patentability & draft patents in minutes with Patsnap Eureka AI!

Acid alpha-glucosidase and fragments thereof

Inactive Publication Date: 2005-11-03
BIOMARIN PHARM INC
View PDF3 Cites 95 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0005] The present invention permits M6P-independent targeting of human GAA or GAA-like enzymes to patient lysosomes by using a peptide tag-based targeting strategy. As a result, the present invention provides efficient delivery of GAA or GAA-like enzymes into target cells.

Problems solved by technology

Accumulated glycogen ultimately impairs muscle function.
Presently, there is no approved treatment available to cure or slow the progress of Pompe disease.
Therefore, M6P-dependent delivery of recombinant GAA to lysosomes is not efficient, requiring high dosages and frequent infusions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acid alpha-glucosidase and fragments thereof
  • Acid alpha-glucosidase and fragments thereof
  • Acid alpha-glucosidase and fragments thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Trans Expression of GAA.

[0099] The following primers were used to generate a gene cassette containing the human IGF-II signal sequence fused to human GAA residues 791-952 (the C-terminal domain).

(SEQ ID NO:_)GAA41: GGAATTCAGGCGCGCCGGCAGCTCCCCGTGAGCCAGCC(SEQ ID NO:_)GAA 27: GCTCTAGACTAACACCAGCTGACGAGAAACTGC

GAA41 and GAA27 were used to amplify the C-terminal domain of GAA by PCR. The amplified fragment contains an Asc I site at the 5′ terminus. The SS N-tag encoding the IGF-II signal sequence (residues 1-25) with an AscI site at the 3′ end was then fused at the Asc I site to the GAA C-terminal domain and the cassette was cloned in pCEP4 to generate plasmid pCEP-SS-GAA-791-952. The SS N-tag nucleic acid sequence is shown as below.

[0100] DNA sequence of the SS N-tag:

gaattcACACCAATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTggcgcgccg

[0101] The following additional plasmids were generated similarly: pCEP-GAA Δ 817-952 that lacks C-terminal GAA residues ...

example 3

Construction of a GAA Protein With an Internal GILT Tag

[0108] PCR was used to first generate an insertion of the nucleotide sequence GGCGCGCCG (SEQ ID NO:_) after nucleotide 2370 of the complete human GAA sequence (SEQ ID NO:_). This insertion forms an AscI restriction site preceding Ala791. The GILT tag was PCR-amplified with the following DNA oligos:

(SEQ ID NO:_)IGF7: gctctagaggcgcgccCTCGGACTTGGCGGGGGTAGC(SEQ ID NO:_)IGF8: ggaattcaggcgcgccgGCTTACCGCCCCAGTGAGAC

The amplified GILT tag contains an AscI restriction site at each terminus. This GILT tag was digested with AscI and inserted into the AscI site preceding GAA Ala791 as described above. DNA sequencing confirmed the in-frame orientation of the GILT insertion. This GAA cassette containing an internal GILT tag preceding Ala791 was expressed in vector pCEP4 in a plasmid named pCEP-GAA-IRGILT-4. pCEP-GAA-IRGILT-4 was found to contain a PCR-generated mutation T1712C within the GAA coding sequence. This construct produced functio...

example 4

GAA Deletion Constructs With N-terminal GILT Tag

[0109] A set of five tags suitable for N-terminal GAA expression (N-tags) were generated by PCR amplification using primers indicated in Table 3. The GILT N-tag contains the native IGF-II signal sequence and complete GILT epitope. The SS N-tag contains only the IGF-II signal sequence.

[0110] For example, the GILTΔ1-7 N-tag contains the IGF-II signal sequence and GILT epitope residues 8-67. It was generated with three PCR reactions: (1) PCR amplification from human IGF-II DNA template using primers IGF1 and IGF4; (2) PCR amplification from human IGF-II DNA template using primers IGF2 and IGF7; and (3) PCR amplification from the products of the first two PCR reactions using primers IGF1 and IGF7.

[0111] The GILTΔ2-7 N-tag contains the IGF-II signal sequence, and GILT epitope residue 1 followed by residues 8-67. It was generated with three PCR reactions: (1) PCR amplification from human IGF-II DNA template using primers IGF1 and IGF5; (2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Login to View More

Abstract

Targeted acid alpha-glucosidase therapeutics that localize to the lysosome are provided. The targeted therapeutics include a therapeutic agent, GAA, and a targeting moiety that binds a receptor on an exterior surface of the cell, permitting proper subcellular localization of the targeted therapeutic upon internalization of the receptor. Nucleic acids, cells, and methods relating to the practice of the invention are also provided.

Description

REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Ser. No. 60 / 543,812, filed Feb. 10, 2004, the contents of which are incorporated by reference.BACKGROUND [0002] Acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes the alpha 1-4 linkage in maltose and other linear oligosaccharides, including the outer branches of glycogen, thereby breaking down excess glycogen in the lysosome (Hirschhorn et al. (2001) in The Metabolic and Molecular Basis of Inherited Disease, Scriver, et al., eds. (2001), McGraw-Hill: New York, p. 3389-3420). Like other mammalian lysosomal enzymes, GAA is synthesized in the cytosol and traverses the ER where it is glycosylated with N-linked, high mannose type carbohydrate. In the golgi, the high mannose carbohydrate is modified on lysosomal proteins by the addition of mannose-6-phosphate (M6P) which targets these proteins to the lysosome. The M6P-modified proteins are delivered to the lysosome via interaction with eit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/00A61K38/47C12N9/24C12N9/26C12N15/62C12P21/04
CPCC12N9/2408A61K38/47A61P21/00A61P3/08A61P43/00
Inventor LEBOWITZ, JONATHANMAGA, JOHN
Owner BIOMARIN PHARM INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com