Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for predicting the athletic performance potential of a subject

Inactive Publication Date: 2011-10-27
UNIV COLLEGE DUBLIN NAT UNIV OF IRELAND DUBLIN
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0194]Operating costs can be reduced and racing strategy can be fine tuned by:
[0203]For example, for the Ins227 bp polymorphism for foals, young stock and horses-in-training selection of individuals may be made for individuals most likely to perform well as two year olds (Ins227 bp / Ins227 bp and Ins227 bp / Normal) and against ‘backward’ individuals (industry terminology for less physically developed young Thoroughbreds) that may benefit from waiting to race until they are three years old (Normal / Normal). Breeding objectives may be more confidently met by selecting Ins227 bp / Ins227 bp individuals for short distance racing, Ins227 bp / Normal individuals for middle-distance racing and Normal / Normal individuals for racing requiring greater stamina. For stallion owners, prediction of a stallion's genetic stamina index at the outset of a stud career (five years are required to estimate S.I. from retrospective three year old progeny racing performance) will immediately enhance a young stallion's profile and promote their genetic potential to mare owners. This in turn will enable mare owners, with targeted breeding strategies, to better select stallions to achieve specific breeding objectives. To eliminate uncertainty from a mating outcome (unless both sire and dam are homozygous) it will be necessary to genotype the foal, enabling selection of individuals for a targeted breeding outcome.Example 7Application of the Assay to Determine Speed Measured by GPS
[0257]Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG, Ostrander EA. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007 May 25; 3(5):e79. Epub 2007 Apr. 30.

Problems solved by technology

In particular, whippet racing dogs that are heterozygote for a MSTN polymorphism have significantly greater racing ability than both homozygote wild-type dogs and homozygotes for the mutation that have an increased musculature that is detrimental to performance (Mosher et al.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for predicting the athletic performance potential of a subject
  • Method for predicting the athletic performance potential of a subject
  • Method for predicting the athletic performance potential of a subject

Examples

Experimental program
Comparison scheme
Effect test

example 1

Genome-Wide SNP-Association Study & Candidate Performance-Associated Genes

Genome-Wide SNP-Association Study

[0140]We have previously described an association between optimum racing distance and a SNP (g.66493737C>T) in the equine MSTN gene in Thoroughbred Flat racehorses (Hill et al. 2010, the entire contents of which is incorporated herein by reference). Candidate gene approaches are designed considering a priori hypotheses and do not allow the opportunity for evaluation of the effect of the gene in the context of the entire genome, nor do they allow for the identification of other genes contributing to the phenotype (Tabor et al. 2002; Jorgensen et al. 2009). Therefore, employing a hypothesis-free approach we investigated genome-wide influences on optimum racing distance by conducting a genome-wide SNP-association study in a cohort of elite Thoroughbred racehorses.

[0141]In a cohort-based genotype-phenotype investigation we compared two cohorts: short (≦8 f) and middle-long (>8 f) d...

example 2

Polymorphism Detection in Equine MSTN Flanking Sequences

[0147]We have previously identified SNPs in intron 1 of the equine MSTN gene by re-sequencing the coding and intronic sequence [PCT / IE2009 / 000062 and Hill et al. 2010, the entire contents of which are incorporated herein by reference]. Details of two of the SNPs identified in Intron 1 are shown in Table 3 below.

TABLE 3SNPs in intron 1 of the MSTN geneLocation (bp)on   ECA 18FlankingSNP IDSNP(EquCab2)StructureSequenceMSTN-T:C66493737Intron 1AGCTAAGCAAGTAATTAGCACAAAAA66493737TTTGAATGTTATATTCAGGCTATCTCA(T / C)AAAGTTAGAAAATACTGTCTTTAGAGCSNPCAGGCTGTCATTGTGAGCAAAATCACTAGCAATTTCTTTTATTTTGGTTCCCCAAGATTGTTTATAAATAAGGTAAATCTACTCCAGGACTATTTGATAGCAGAGTCATAAAGGAAAATTA[T / C]TTGGTGCATTATAACCTGATTACTTAATAAGGAGAACAATATTTTGAAACTGTTGTGTCCTGTTTAAAGTAGATAAAGCACTGGGTAAAGCAGGATCGCAGACACATGGCACAGAAGGTGTCTGTCTCCCTTTCCTTGAGTGTAGTTATGAACTGACTGCAAAAAGAATATATG (SEQ ID No. 19)MSTN-A:C66494218Intron 1AGGAGATTATTAAGCAATGTGCCTGCC66494218TGGAAATGTGCACCCCGGGTGCTCTC...

example 3

MSTN Ins227 bp Polymorphism (Chr182.66495327Ins227 bp66495326)

[0158]This insertion polymorphism is located on Chromosome 18 of Equus caballus at position 66495327Ins227 bp66495326 reverse strand of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu / mammals / horse / .

[0159]The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79× and was released in September 2007. A female Thoroughbred named “Twilight” was selected as the representative horse for genome sequencing. (Wade C. M., et al Science 326, 865-7).

[0160]The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Electrical conductanceaaaaaaaaaa
Dimensionless propertyaaaaaaaaaa
Dimensionless propertyaaaaaaaaaa
Login to View More

Abstract

A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T / C) SNP. The invention also provides an assay for determining the athletic performance potential of a subject.

Description

[0001]The invention relates to a method for predicting the athletic performance potential of a subject.INTRODUCTION[0002]Myostatin gene (MSTN) variants have previously been shown to contribute to muscle hypertrophy in a range of mammalian species (Grobet et al. 1997; McPherron et al. 1997; McPherron & Lee 1997; Schuelke et al. 2004; Mosher et al. 2007). In particular, whippet racing dogs that are heterozygote for a MSTN polymorphism have significantly greater racing ability than both homozygote wild-type dogs and homozygotes for the mutation that have an increased musculature that is detrimental to performance (Mosher et al. 2007). Horses, in particular Thoroughbreds, have a very high muscle mass to body weight ratio (55%) compared to other mammalian species (30-40%) (Gunn 1987) and the Thoroughbred genome contains evidence for selection for muscle strength phenotypes (Gu et al. 2009).[0003]The Thoroughbred horse industry is a multi-billion dollar international enterprise engaged in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/124A01K67/02A01K15/02C12Q2600/156C12Q1/6876C12Q2600/158
Inventor HILL, EMMELINEMACHUGH, DAVIDGU, JINGJINGMCGIVNEY, BEATRICE
Owner UNIV COLLEGE DUBLIN NAT UNIV OF IRELAND DUBLIN