Recombinant phage and methods

a phage and phage technology, applied in the field of recombinant phage and methods, can solve the problems of limiting the natural host range of the phage engineered to date, affecting the engineering efficiency of the phage, and general lack of methods

Active Publication Date: 2013-05-16
INST FOR ENVIRONMENTAL HEALTH
View PDF2 Cites 38 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes methods for making a recombinant phage genome by inserting a starting phage genome into a vector and propagating it in a vector host cell that is not a phage host cell. The methods involve co-transforming the starting phage genome and the vector into a plurality of vector host cells and selecting a vector host cell that contains the recombinant phage genome. The recombinant phage genome can then be removed from the vector and used to produce phage particles. The methods can be used to create recombinant phage genomes that are useful for research and development of phage-based technologies.

Problems solved by technology

The natural host range of the phage engineered to date is a limitation, however, and those phage don't infect many relevant bacteria and biofilms.
To date such methods have in general been lacking, however, and therefore additional methods of engineering phage will be useful.
Engineering diverse phage is generally made more difficult by the properties of phage genomes.
For example, phage genomes have relatively few restriction sites and are heavily modified, making use of traditional cloning techniques with phage challenging.
Phages also have compact genomes with very little non-coding DNA, which can make it challenging to find sites within the genome that are compatible with traditional engineering.
However, the process must be completed before any engineered phage can be tested.
With this result, the process was deemed unsuitable for many uses.
The methods and recombinant vectors, phage genomes, and phage provided herein are a major advancement over current phage engineering technologies which rely on in vitro strategies, which are generally inefficient and challenging to scale up, or on engineering phages within bacteria, which is generally problematic due to toxicity of phages to bacteria and the difficulty in maintaining the stability of large engineered genomes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant phage and methods
  • Recombinant phage and methods
  • Recombinant phage and methods

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning and Genetically Modifying Phage T3

[0220]A. Phage Capture

[0221]Phage T3 was cloned and manipulated in the following manner. T3 was grown using E. coli DH10B as a host, grown in Luria Broth (LB)+2 mM calcium chloride. The phage lysate was concentrated via incubation with 10% polyethylene glycol-8000 overnight at 4° C., followed by centrifugation. The pellet was resuspended in SM buffer (Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001)). DNA was prepared from the concentrated T3 lysate using the Norgen Phage DNA kit (Cat#46700). The genomic sequence of T3 (NCBI accession #NC 003298) was used to design oligos to capture T3 into the pYES1L vector (Invitrogen®). Oligos used were duplexes of:

[SEQ ID NO: 1]CCTAGTGTACCAGTATGATAGTACATCTCTATGTGTCCCTCCTCGCCGCAGTTAATTAAAGTCAGTGAGCGAGGAAGCGCand its complement,

and duplexes of:

[SEQ ID NO: 2]GAACGACCGAGCGCAGCGGCGGCCGCGCTGATACCGCCGCTCTCATAGTTCAAGAACCCAAAGTACC...

example 2

Cloning and Genetically Modifying Phage T7

[0235]A. Phage Capture

[0236]T7 luc was created in a slightly different manner than the engineered T3 phage of Example 1.

[0237]T7 dspB (T. K. Lu and J. J. Collins, “Dispersing Biofilms with Engineered Enzymatic Bacteriophage,” Proceedings of the National Academy of Sciences, vol. 104, no. 27, pp. 11197-11202, Jul. 3, 2007, incorporated herein by reference) was captured in pYES1L by transforming genomic DNA of T7 dspB, YAC pYES1L, a duplex of:

[SEQ ID NO: 11]TTGTCTTTGGGTGTTACCTTGAGTGTCTCTCTGTGTCCCTCCTCGCCGCAGTTAATTAAAGTCAGTGAGCGAGGAAGCGC

and its complement, and a duplex of:

[SEQ ID NO: 12]CCCGAACGACCGAGCGCAGCGGCGGCCGCGCTGATACCGCCGCCGCCGGCGTCTCACAGTGTACGGACCTAAAGTTCCCCCATAGGGGGT

and its complement,

into MaV203 yeast cells (Invitrogen®). Those oligonucleotides bridge the ends of the T7 genomic sequence (NC—001604) and the YAC vector.

[0238]B. YAC to Plaque

[0239]Cloned T7 phages were shown to be able to YAC-to-plaque, as above.

[0240]Selected MaV203 cel...

example 3

Cloning and Genetically Modifying Phage T3

[0246]Phage T3 was captured into the pYES1L vector (Invitrogen®) and shown to be functional in the YAC to plaque assay as described in Example 1.

[0247]A. Luciferase and Nanoluc Insertion into T3 Phage

[0248]The T3 luciferase cassette was constructed as in Example 1.

[0249]Promega® vector pNL1.1 was the template for amplification of the nanoluc ORF with primers JHONO319 and JHONO320. pRS426 was used as a template for the Ura3 gene with primers JHNO321 and JHONO322. The sequences of those primers are:

JHONO319[SEQ ID NO: 16]AATTTACTCTTTACTCTTACAGATAACAGGACACTGAACGATGGTCTTCACACTCGAAGAJHONO320[SEQ ID NO: 17]TTACGCCAGAATGCGTTCGCACJHONO321[SEQ ID NO: 18]AGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAACAGATTGTACTGAGAGTGCACCJHONO322[SEQ ID NO: 19]ATTCAGGCCACCTCATGATGACCTGTAAGAAAAGACTCTACACACCGCATAGGGTAATAACTG.

[0250]In each case (luc cassette and nanoluc cassette), 2 PCR products were created, and co-transformed into yeast containing the T3-YAC described above ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Tmaaaaaaaaaa
temperaturesaaaaaaaaaa
sizeaaaaaaaaaa
Login to View More

Abstract

This disclosure provided methods of cloning a phage genome. Also provided are methods of making a recombinant phage genome. In some embodiments the phage genome is engineered to comprise a heterologous nucleic acid sequence, for example a sequence comprising an open reading frame. In some embodiments the phage genome is cloned in a yeast artificial chromosome. Recombinant phage genomes and recombinant phage are also provided. In some embodiments the methods are high throughput methods such as methods of making a plurality of recombinant phage genomes or recombinant phage. Collections of recombinant phage genomes and recombinant phage are also provided.

Description

REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to U.S. Provisional Patent Application No. 61 / 539,454, filed Sep. 26, 2011; U.S. Provisional Patent Application No. 61 / 549,743, filed Oct. 20, 2011; and U.S. Provisional Patent Application No. 61 / 642,691, filed May 4, 2012. The entire contents of each of those applications are hereby incorporated herein by reference.SEQUENCE LISTING[0002]The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 14, 2012, is named 1211USNP.txt and is 12,065 bytes in size.INTRODUCTION[0003]Model phage have been engineered using molecular biology techniques to deliver heterologous protein products to bacterial cells. For example, phage have been engineered to deliver enzymes to biofilms to digest the extracellular matrix and destroy the biofilm. (E.g., U.S. Patent Application Publication No. 2009 / ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12P19/34
CPCC12P19/34C12N15/10C12N15/81C12N2800/206C12N2795/10143C12N2795/10243C12N15/86C12N7/00C12N2795/10221C12N2795/10251
InventorLU, TIMOTHY KUAN TAKOERIS, MICHAEL SANDORCHEVALIER, BRETT SMITHHOLDER, JASON WYATTMCKENZIE, GREGORY JOHNBROWNELL, DANIEL ROBERT
OwnerINST FOR ENVIRONMENTAL HEALTH