Methods of diagnosing increased risk of developing mrsa

a technology of increased risk and diagnostic method, applied in the direction of microbiological testing/measurement, biochemistry apparatus and processes, etc., can solve the problems of mrsa being particularly difficult to diagnose and populations may also have an elevated risk of developing mrsa

Inactive Publication Date: 2017-03-23
WILLIAM BEAUMONT HOSPITAL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

Enables accurate prediction of MRSA infection risk, enabling personalized treatment approaches and reducing the incidence of MRSA infections by tailoring interventions based on individual risk profiles.

Problems solved by technology

ns. As such, MRSA is particularly hard to tr
Skin wounding events or other forms of compromise to skin integrity (e.g., intravenous drug use) are another major risk for MRSA infection, which risk may or may not coincide with the exposure risk.
Such populations may also have an elevated risk for developing MRSA if admitted to medical care facilities.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

Study Design

[0122]Fourteen participants were contacted and consented to collection of blood samples for analysis. Collection and analysis were approved through the Beaumont Institutional Review Board. Eleven participants were patients who were seen for recurrent community acquired MRSA skin infections (CA-MRSA) but had no known specific risk factors for developing recurrent infection. Three participants were controls and were cohabiting spouses of three of the patients. This gave controls who were directly and closely exposed to the patient (i.e., shared a bed) and were thus within the same environment but did not become infected with CA-MRSA.

example 2

Methods

[0123]Collection and analysis was done via the Beaumont BioBank. Analysis was performed in an automated and blinded manner. Genomic DNA from all participants was prepared for analysis using Affymetrix Genome-wide Human SNP 6.0 microarrays. Each array contains more than 946,000 probes for detection of copy number variation and more than 906,000 single nucleotide polymorphism (SNP) probes for genotyping. One array per patient sample was prepared according to the manufacturer's protocol and scanned with an Affymetrix GeneChip® Scanner 3000. Affymetrix Genotyping Consol software and the Partek Genomics Suite were used for analysis and visualization of the data.

[0124]Data was subjected to per SNP and per sample quality control to minimize false positives. None of the remaining samples from individuals were excluded based on the expression data. SNPs from X and Y chromosomes were excluded from further analysis. SNPs with no call rates 5% were included for further analysis. The fina...

example 3

Results

[0129]The analysis using each model revealed several potential SNPs of interest, but the most significant (p value 1.21×10-7) was located within the open reading frame of a gene identified as FAM129B. This SNP (SNP_A 8307872, rs2249861) was present with two copies of a single form in all 11 MRSA patients and with two copies of another form in all three controls. There were no participants who were heterozygous (one copy of the gene in each form).

[0130]The particular SNP in gene FAM129B which segregated between the control and CA-MRSA populations was located in an intron sequence. The SNP has the following sequence in CA-MRSA subjects: GGGGGCAAGTTAGTCAACCTGTCTGAGTCTTAG [SEQ ID NO:1] with the SNP location at position 17 underlined. Control populations had the alternate allele: GGGGGCAAGTTAGTCACCCTGTCTGAGTCTTAG [SEQ ID NO. 2] at position 17.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for diagnosing increased risk of developing Methicillin-resistant Staphylococcus aureus (MRSA) hospital-acquired (HA-MRSA) or community-acquired MRSA (CA-MRSA) which includes obtaining a biological sample from a subject, detecting in the sample a single nucleotide polymorphism (SNP) in the FAM129B gene at position 17 of SEQ ID NO 1, and comparing the nucleotide at position 17 of SEQ ID NO. 1 in the sample with the nucleotide at position 17 in SEQ ID NO. 1, wherein an adenine at position 17 of SEQ ID NO. 1 in the sample indicates an increased risk of developing MRSA or CA-MRSA in the subject.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority from U.S. Provisional Application No. 61 / 779,307, filed Mar. 13, 2013, the entire contents of which are incorporated by reference.SEQUENCE LISTING[0002]This application incorporates in its entirety the Sequence Listing entitled “2014-03-10_5475-353958_056-US_SEQ_LISTING_ST25.txt” (96,447 bytes), which was created on Mar. 10, 2014, and filed electronically herewith.BACKGROUND OF THE INVENTION[0003]Staphylococcus aureus (staph) bacteria are a common component of the skin surface and lining of the nasal passageways in humans and other animals, and are usually spread by skin-to-skin contact. Methicillin-resistant S. aureus (MRSA) is a strain of S. aureus that has become resistant to methicillin, an antibiotic commonly used to treat ordinary S. aureus infections. As such, MRSA is particularly hard to treat. When limited to the skin surface and lining of the nasal passageways, S. aureus bacteria are normally har...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q2600/156C12Q1/689C12Q1/6883
InventorSIMS, MATTHEW
OwnerWILLIAM BEAUMONT HOSPITAL