Unlock instant, AI-driven research and patent intelligence for your innovation.

Diagnostic kits

Inactive Publication Date: 2018-08-02
AZOTIC TECH LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent is about a method to evaluate the colonization of a plant by a strain of Gluconacetobacter diazotrophicus (Gd) using a kit that includes a set of primers to amplify DNA. This allows farmers to make an informed decision about the success and efficiency of colonization, which will help them determine the amount of chemical based nitrogen fertilizer needed. The method involves amplifying the DNA of Gd using a technique called LAMP reaction, which can be performed using different detection methods such as gel electrophoresis or real-time monitoring. The sample used in the method can be a culture or a plant sample containing the desired strain of Gd. The technical effect of this patent method is to provide an assurance to farmers that their crops are being well-tended by identifying and confirming the successful colonization of plants by Gd.

Problems solved by technology

However, a wide range of strains of Gd exist and it has not yet been possible to provide a means for easily identifying strains which have these beneficial properties.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnostic kits
  • Diagnostic kits
  • Diagnostic kits

Examples

Experimental program
Comparison scheme
Effect test

example 1

Identification of Unique Sequences

[0053]IMI504958, a Gd strain derived from passaging UAP5541, which was found to have particularly beneficial plant colonisation properties was isolated and the full genome sequenced. A comparison was made against the publically available genome of the type strain (PAL5; sequenced by JGI, USA [Genbank sequence accession CP001189]) using standard methods.

[0054]Surprisingly, a large number of differences were noted in the genome, and in particular, a number of genes were identified which are present in the genome of IMI504958 but not PAL5.

[0055]Many of these genes were annotated with an associated function. The unique genes with annotations were further checked for uniqueness across all the genomes sequenced to date using the NCBI's web-based BLAST tool.

[0056]Analysis of the BLAST result narrowed the list to 20 unique genes not present in any genome. These unique genes appeared to be “strain-specific” for IMI504958.

[0057]Also, five sets were found to b...

example 2

PCR Validation

[0059]A set of 25 primer sets were designed based upon the sequences identified in the analysis of the genome. The specificity of these 25 primer sets (20 designed to be strain-specific and 5 designed to be species-specific) were first tested by carrying out a conventional PCR reaction using genomic DNA of IMI504958 and PAL5. The results with IMI504958 are illustrated in FIGS. 1A-B. Results showed that 16 strain-specific primer sets delineated IMI504958 from PAL5 as obtained from three different collections (ATCC49037, DSM5601 and LMG7603). However, 4 putative strain-specific primer sets cross-reacted with at least one PAL5 and hence were removed from strain-specific study.

[0060]All 5 species-specific primers reacted as expected.

[0061]Further, testing of strain- and species-specific primers was done against two other strains of Gd, one originally isolated in India (IMI 502398) and the other from Mauritius (IMI 502399), as well as a revived 2001 culture of UAP5541 strai...

example 3

LAMP Assay

[0069]A series of LAMP primers were designed to amplify regions of SEQ ID NOS 6, 7 and 9 and are shown in Table 4 below as follows:

TABLE 4SEQIDNOSequenceType40CTCAGGAAGACCGAATTGATTAF341GCGAAACGTCTGATTGAACB342CGGATAACCACTGGTGCTCCGACTCGCCTCACTCTACTFIP43TCCACGAATCTCACGAAGCACCCCGACCTTATCTCCCATBIP44GCCAGGCGTGTACATATAACTAFL45CGGAATACCTAGTTGGAACACTBL46TCAAGATCGATGCACCTATTCF347AACAGACAGTTCTGGTAGGAB348CGCATCTCCAGATCGGCAGGTCGTCCAGTCGATCATGFIP49ACATCTGTCCACGGCATTGGTGGCTGGCTTATGAGTCTBIP50GAGAAGTCCTCTGCTTCGGFL51CGGCGGTTGAGAAGATGTBL52GGAAGACATCAACGAAGCAF353TTGACAGTTGCATAGTCCGB354ATACGGCTCGTCATGTCGCGGTGATGGATAATCTCAGCCFIP55CAGTGGCCGAACCTGGAAGCGCTGATATAAGCCTGAAGATBIP56ATTGCACCGCGTTGATGFL57GCGTAACGGTCACAAGGABL

[0070]SEQ ID NOS 40-45 were designed to amplify SEQ ID NO 6 above, SEQ ID NOS 46-51 were designed to amplify SEQ ID NO 7 above, and SEQ ID NOS 52-57 were designed to amplify SEQ ID NO 9 above.

[0071]These primers were obtained and tested in a LAMP assay on samples comprising pure Gd DN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Densityaaaaaaaaaa
Densityaaaaaaaaaa
Densityaaaaaaaaaa
Login to View More

Abstract

The invention provides a diagnostic kit comprising means to determine the presence in a sample of preferred strains the nitrogen-fixing bacteria Gluconacetobacter diazotrophicus (Gd) which are based upon the finding that such strains comprises unique nucleic acid sequences and other features, that are detectable, even in the presence of plant genomic DNA. Methods for using the kits in agriculture are also described and claimed.

Description

[0001]The present invention relates to a diagnostic kit, able to identify particular strains of the nitrogen-fixing bacteria Gluconacetobacter diazotrophicus (Gd) that have good utility in agriculture, in terms of their ability to colonise plant cells intracellularly, giving rise to particularly effective nitrogen fixation, as well as to reagents for use in the kits. Novel strains that are identified by the kits form the subject of a co-pending application.BACKGROUND OF THE INVENTION[0002]Gluconacetobacter diazotrophicus (Gd) has been well studied for its nitrogen fixing and plant growth promoting activities as reviewed in Eskin et al. International Journal of Agronomy (2014):1-13. Certain strains of Gd however have been shown to be particularly advantageous in the treatment of plants since they are able to establish themselves intracellularly within plant cells along with exhibiting species and tissue independence (Cocking et al., In vitro Cellular & Developmental Biology Plant (20...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C05F11/08A01N63/20
CPCC12Q1/689C05F11/08A01N63/20A01N63/00C12N1/20C12R2001/02C12N1/205A01C1/06
Inventor DENT, DAVIDPATEL, DHAVALDEVINE, GARY
Owner AZOTIC TECH LTD