Expression of products from nucleic acid concatemers
a technology of nucleic acid concatenates and products, applied in the field ofratiometric coexpression, can solve the problems of increasing the size of the plasmid construct, complex production of such multi-component expression products, and significant challenge to the cgmp (clinical good manufacturing) process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
etric Expression of Adeno-Associated Virus (AAV) Capsid Proteins from 1:1:10 RCA Mixtures
[0075]Stoichiometric expression of VP1, VP2, and VP3 capsid proteins was demonstrated by mixing and supplementing RCA DNA at a 1:1:10 ratio in cell-free protein expression reactions as shown in FIG. 11. Minimalistic expression sequences separately-encoding VP1, VP2, and VP3 were designed in silico and synthesized in vitro (SEQ ID #1-#3).
SEQ ID #1CCGGGATCCTTCTTTAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTGCTGACGGATATCTGCCGGATTGGTTGGAAGATAACCTTAGCGAAGGTATACGAGAGTGGTGGGATTTGAAGCCAGGGGCACCAAAGCCGAAGGCAAATCAACAAAAGCAAGACGACGGACGTGGATTGGTGTTGCCGGGATATAAGTATTTGGGACCGTTTAACGGTCTTGATAAGGGCGAGCCAGTTAACGCAGCAGACGCTGCAGCATTAGAACACGATAAGGCATACGATCAACAACTTAAGGCGGGGGATAACCCTTACCTTCGTTACAATCACGCTGACGCCGAGTTTCAAGAAAGGTTGCAAGAAGATACGAGCTTTGGTGGTAACCTTGGACGAGCAGTGTTCCAAGCTAAGAAGCGGGTCCTAGAGCCGTTTGGACTTGTTGAAGAAGGCGCAAAAACAGCACCTGGAAAGAAGAGACCGGTAGAGCAAAGCCCACAAGAGCCGGA...
example 2
etric Expression of Immunoglobulin Chains from 1:2 RCA Mixtures
[0077]Stoichiometric expression of immunoglobulin heavy and light chains is demonstrated using two different RCA nucleic acid concatemer products. Minimalistic expression sequences separately-encoding IgG heavy and light chains were designed in silico and synthesized in vitro (SEQ ID #4-#5).
SEQ ID #4CCGGGATCCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTAATTCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCACCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCAAGTGGGTCACCTTCATCTCCCTGCTGTTCCTCTTCTCGTCTGCCTACTCCGACATTCAAATGACACAGT...
example 3
on of RCA Mixtures for Functional AAV Virus Production
[0079]Recombinant AAV manufacturing generally involves simultaneous transfection of 3 different plasmids (Rep / Cap, Helper, and a packaged DNA transgene) into HEK293T producer cells. Transient transfection practices are used when manufacturing viral vectors for clinical trials because therapeutic virus can be produced rapidly at high yield, with generally higher titers (without significant pre-optimization) from anchorage-dependent producer cells compared to suspension-adapted cells. However, scale-up manufacturing of AAV is limited by the lead-time and expense of manufacturing plasmid DNA. Here, efficient production of functional AAV virus vector was shown by formulating and transfecting mixtures of RCA DNA (encoding Rep / Cap, Helper, and a GFP transgene) at 1:1:1 ratios in HEK293T cells. Plasmids encoding Rep / Cap (pAAV-RC6, Agilent Genomics), Helper (pHelper, Agilent Genomics), and a packaged DNA transgene (pscAAV-GFP, Cell Biola...
PUM
| Property | Measurement | Unit |
|---|---|---|
| time | aaaaa | aaaaa |
| molar ratio | aaaaa | aaaaa |
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


