Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression of products from nucleic acid concatemers

a technology of nucleic acid concatenates and products, applied in the field ofratiometric coexpression, can solve the problems of increasing the size of the plasmid construct, complex production of such multi-component expression products, and significant challenge to the cgmp (clinical good manufacturing) process

Pending Publication Date: 2022-08-04
GLOBAL LIFE SCI SOLUTIONS USA LLC
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach achieves robust and predictable co-expression of recombinant products with improved purity and reduced production costs, facilitating scalable and cost-effective manufacturing of therapeutic agents like viral vectors and antibodies.

Problems solved by technology

However, certain desired products may involve multiple components that are complexed or that otherwise operate together.
Production of such multi-component expression products may be complex.
However, certain challenges are associated with using multiple plasmid constructs in cells.
One of the challenges is the ratiometric control of co-expression of multiple plasmid constructs.
For example, a single dual promotor plasmid with an internal ribosome entry site (IBES) and a viral 2A peptide can be used to drive co-expression of two or more proteins with reduced heterogeneity, although this requires the expense of laboriously cloning each open reading frame into the multi-cistronic plasmid and consequently increasing the size of the plasmid construct.
In addition, since plasmids contain additional sequences necessary for maintenance in bacteria, the use of plasmids requires post-production purifications and QC analytics to prove absence of bacterial contaminants in the plasmid production, which posts a significant challenge for cGMP (clinical good manufacturing) process.
The latter is especially challenging as the size of the plasmid construct increases and becomes difficult to distinguish from bacterial chromosomal DNA, which complicates post-production purification of plasmid DNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression of products from nucleic acid concatemers
  • Expression of products from nucleic acid concatemers
  • Expression of products from nucleic acid concatemers

Examples

Experimental program
Comparison scheme
Effect test

example 1

etric Expression of Adeno-Associated Virus (AAV) Capsid Proteins from 1:1:10 RCA Mixtures

[0075]Stoichiometric expression of VP1, VP2, and VP3 capsid proteins was demonstrated by mixing and supplementing RCA DNA at a 1:1:10 ratio in cell-free protein expression reactions as shown in FIG. 11. Minimalistic expression sequences separately-encoding VP1, VP2, and VP3 were designed in silico and synthesized in vitro (SEQ ID #1-#3).

SEQ ID #1CCGGGATCCTTCTTTAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTGCTGACGGATATCTGCCGGATTGGTTGGAAGATAACCTTAGCGAAGGTATACGAGAGTGGTGGGATTTGAAGCCAGGGGCACCAAAGCCGAAGGCAAATCAACAAAAGCAAGACGACGGACGTGGATTGGTGTTGCCGGGATATAAGTATTTGGGACCGTTTAACGGTCTTGATAAGGGCGAGCCAGTTAACGCAGCAGACGCTGCAGCATTAGAACACGATAAGGCATACGATCAACAACTTAAGGCGGGGGATAACCCTTACCTTCGTTACAATCACGCTGACGCCGAGTTTCAAGAAAGGTTGCAAGAAGATACGAGCTTTGGTGGTAACCTTGGACGAGCAGTGTTCCAAGCTAAGAAGCGGGTCCTAGAGCCGTTTGGACTTGTTGAAGAAGGCGCAAAAACAGCACCTGGAAAGAAGAGACCGGTAGAGCAAAGCCCACAAGAGCCGGA...

example 2

etric Expression of Immunoglobulin Chains from 1:2 RCA Mixtures

[0077]Stoichiometric expression of immunoglobulin heavy and light chains is demonstrated using two different RCA nucleic acid concatemer products. Minimalistic expression sequences separately-encoding IgG heavy and light chains were designed in silico and synthesized in vitro (SEQ ID #4-#5).

SEQ ID #4CCGGGATCCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTAATTCCGGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCACCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCAAGTGGGTCACCTTCATCTCCCTGCTGTTCCTCTTCTCGTCTGCCTACTCCGACATTCAAATGACACAGT...

example 3

on of RCA Mixtures for Functional AAV Virus Production

[0079]Recombinant AAV manufacturing generally involves simultaneous transfection of 3 different plasmids (Rep / Cap, Helper, and a packaged DNA transgene) into HEK293T producer cells. Transient transfection practices are used when manufacturing viral vectors for clinical trials because therapeutic virus can be produced rapidly at high yield, with generally higher titers (without significant pre-optimization) from anchorage-dependent producer cells compared to suspension-adapted cells. However, scale-up manufacturing of AAV is limited by the lead-time and expense of manufacturing plasmid DNA. Here, efficient production of functional AAV virus vector was shown by formulating and transfecting mixtures of RCA DNA (encoding Rep / Cap, Helper, and a GFP transgene) at 1:1:1 ratios in HEK293T cells. Plasmids encoding Rep / Cap (pAAV-RC6, Agilent Genomics), Helper (pHelper, Agilent Genomics), and a packaged DNA transgene (pscAAV-GFP, Cell Biola...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
timeaaaaaaaaaa
molar ratioaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

Provided are techniques for generating expression products using one or more nucleic acid concatemers that include tandem repeats of a nucleic acid sequence encoding the expression product or products. In one embodiment, different expression products may be co-expressed using a concatemer mixture of a first nucleic acid concatemer and a second nucleic acid concatemer having a predefined ratio to one another.

Description

[0001]SEQUENCE LISTING[0002]The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 15, 2019, is named 324586-1_SL.txt and is 13,566 bytes in size.TECHNICAL FIELD[0003]The disclosure generally relates to expression of recombinant products from nucleic acid concatemers, and, in certain embodiments, relates to a ratiometric co-expression of recombinant products from nucleic acid concatemers. The ratiometric co-expression has been demonstrated in both in vivo and cell free expression systems.BACKGROUND[0004]Recombinant products, including proteins, antibodies, and nucleic acids, have been widely used in clinical applications. Such recombinant products may harness nucleic acid and / or protein expression machinery to generate products of interest with clinical utility. For example, immunotherapy and other cell therapies frequently utilize viral vecto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12P21/02C12N7/00C12N15/10C12N15/86C12P19/34
CPCC12P21/02C12N7/00C12N2015/8518C12N15/86C12P19/34C12N15/1003C12N15/63C12N15/67C12N2740/16043C12N2740/16051C12N2750/14123C12N2750/14143C12N2750/14151C12N15/64C12Q2531/125
Inventor DAVIS, BRIAN MICHAELKVAM, ERIK LEEMINGNELSON, JOHN RICHARDLOWERY, LISA A.GAO, WEI
Owner GLOBAL LIFE SCI SOLUTIONS USA LLC