Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Ligase/polymerase method for detecting cytosine methylation in DNA samples

a ligase/polymerase and dna technology, applied in the direction of material testing goods, biochemistry apparatus and processes, sugar derivatives, etc., can solve the problems of incomplete loss of epigenetic information carried by the 5-methylcytosine during pcr amplification, and the inability to identify the 5-methylcytosine position by sequencing, so as to achieve better detection

Inactive Publication Date: 2008-07-29
EPIGENOMICS AG
View PDF11 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0042]Herein it is particularly preferred that the produced fragments have a single positive or negative net charge for better detectability in the mass spectrometer.

Problems solved by technology

However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine.
Moreover, the epigenetic information carried by the 5-methylcytosines is completely lost during PCR amplification.
However, 5-methylcytosine remains unmodified under these conditions.
Until now, however, only individual regions of a length of up to approximately 3000 base pairs are analyzed; a global analysis of cells for thousands of possible methylation analyses is not possible.
Moreover, this method cannot reliably analyze very small fragments from small sample quantities either.
These are lost in spite of the diffusion protection by the matrix.
DNA itself does not possess any functionalization which is suitable.
The difficulty exists in introducing such a functionalization into a DNA.
For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient.
For DNA, there are currently several responsive matrixes in use, however, this has not reduced the difference in sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0087]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.

[0088]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)). Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D 2), thymidine triphosphate (dTTP, as type D 1) and 2′-desoxyadenosine triphosphate (dATP, as type D 1). If a methylated cytosine was present, the elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hydroxy function at the 3′-end whereas the elongation product ATGTTGGATGTTGTTGAGAAAT (...

example 2

[0090]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.

[0091]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized with its 5′-end to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) which is immobilized to a solid phase surface and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)). Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D 2), thymidine triphosphate (dTTP, as type D 1) and 2′-desoxyadenosine triphosphate (dATP, as type D 1). If a methylated cytosine was present, the solid phase bonded elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hydro...

example 3

[0093]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.

[0094]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)), the latter beeing bonded to a solid phase surface with its 3′-end. Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D2), thymidine triphosphate (dTTP, as type D1) and 2′-desoxyadenosine triphosphate (dATP, as type D1). If a methylated cytosine was present, the solid phase bonded elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hyd...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
distanceaaaaaaaaaa
sizeaaaaaaaaaa
elongationaaaaaaaaaa
Login to View More

Abstract

Described is a method for detecting 5-methylcytosine in genomic DNA samples. First, a genomic DNA from a DNA sample is chemically converted with a reagent, 5-methylcytosine and cytosine reacting differently, and the pretreated DNA is subsequently amplified using a polymerase and at least one primer. In the next step, the amplified genomic DNA is hybridized to at least two oligonucleotides, the latter being joined by inserting at least one oligonucleotide. In the ligation product, one nucleotide carries a detectable label, and the elongation depends on the methylation status of the specific cytosine in the genomic DNA sample. In the next step, the elongated oligonucleotides are analyzed for the presence of the label.

Description

BACKGROUND OF THE INVENTION[0001]The present invention relates to a method for detecting 5-methylcytosine in genomic DNA-samples.[0002]The levels of observation that have been well studied by the methodological developments of recent years in molecular biology are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, the assumption suggests itself that pathogenic conditions express themselves in an altered methylation pattern of individual genes or of the genome.[0003]The present invention describes a method for detecting the methylation state of genomic DNA samples. The method can, at the same time, also be used for detecting point...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(United States)
IPC IPC(8): C12Q1/68C07H21/04G01N27/62C12N15/09C12Q1/6827C12Q1/6834G01N33/53G01N37/00
CPCC12Q1/6827C12Q1/6834C12Q2600/158C12Q2561/125C12Q2533/101C12Q2525/186C12Q2531/113C12Q2523/125
Inventor OLEK, ALEXANDERBERLIN, KURT
Owner EPIGENOMICS AG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com