Ligase/polymerase method for detecting cytosine methylation in DNA samples
a ligase/polymerase and dna technology, applied in the direction of material testing goods, biochemistry apparatus and processes, sugar derivatives, etc., can solve the problems of incomplete loss of epigenetic information carried by the 5-methylcytosine during pcr amplification, and the inability to identify the 5-methylcytosine position by sequencing, so as to achieve better detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
example 1
[0087]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.
[0088]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)). Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D 2), thymidine triphosphate (dTTP, as type D 1) and 2′-desoxyadenosine triphosphate (dATP, as type D 1). If a methylated cytosine was present, the elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hydroxy function at the 3′-end whereas the elongation product ATGTTGGATGTTGTTGAGAAAT (...
example 2
[0090]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.
[0091]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized with its 5′-end to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) which is immobilized to a solid phase surface and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)). Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D 2), thymidine triphosphate (dTTP, as type D 1) and 2′-desoxyadenosine triphosphate (dATP, as type D 1). If a methylated cytosine was present, the solid phase bonded elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hydro...
example 3
[0093]The following example relates to a fragment of exon 23 of the factor VIII gene in which a specific CG-position is to be analyzed for methylation.
[0094]In the first step, the fragment is amplified by primers of type A, namely by ATTATGTTGGAGTAGTAGAGTTTAAATGGTT (SEQ-ID No.: 1) and ACTTAACACTTACTATTTAAATCACAACCCAT (SEQ-ID No.: 2). The amplified DNA is hybridized to an oligonucleotide of type B (for example, ATGTTGGATGTTGTTGAG (SEQ-ID No.: 3)) and a 5′-phosphorylated oligonucleotide of type C (for example, GTATAAAGTAAATTAGAAGGAAGAT (SEQ-ID No.: 4)), the latter beeing bonded to a solid phase surface with its 3′-end. Subsequently, the elongation reaction is carried out with 2′,3′-didesoxycytidine triphosphate (ddCTP, as type D2), thymidine triphosphate (dTTP, as type D1) and 2′-desoxyadenosine triphosphate (dATP, as type D1). If a methylated cytosine was present, the solid phase bonded elongation product ATGTTGGATGTTGTTGAGAAAC (SEQ-ID No.: 5) is produced which does not carry any hyd...
PUM
| Property | Measurement | Unit |
|---|---|---|
| distance | aaaaa | aaaaa |
| size | aaaaa | aaaaa |
| elongation | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More