Rice high efficient expression starter and application thereof

A high-efficiency expression and promoter technology, which is applied in the fields of application, angiosperm/flowering plants, and the introduction of foreign genetic material using vectors, can solve the problems of many copies and weak promoter expression

Inactive Publication Date: 2007-07-18
SHANGHAI NORMAL UNIVERSITY
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is to provide a rice high-efficiency expression promoter and its application to overcome the defects that the existing promoters are relatively weak in expression in monocotyledonous plants or contain more copies in cereal plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice high efficient expression starter and application thereof
  • Rice high efficient expression starter and application thereof
  • Rice high efficient expression starter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Cloning of the promoter and construction of the vector: According to the 10 TUT data with the highest redundancy in the stem library of the Zhejiang University EST database (http: / / www.estarray.org), one of the uncloned promoters was selected, and its GenBank ID For BI807252 (ie Os252), primers were designed and synthesized: F: 5'AGTTTATGTGCTTATACAGATGAG 3'; R: 5'GGTTGAATAAGGAGGAAGC 3'. The total DNA of rice leaves was amplified by PCR, and the product fragment size was 1018bp, which was cloned into T-Vector. The binary vector pCAMBIA 1301 was digested with Hindlll and Ncol, and the large fragment was separated. After the end was filled with T4 polymerase, it was ligated with T4 ligase After constructing the pCAM-Gus vector, the T vector containing the promoter sequence was double-digested with BamH I and Sal I, and the recovered small fragment was ligated with the large fragment of the double-digested pCAM-Gus plasmid to form the rice expression vector pCAMBIA 1301. (F...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to one kind of high efficiency expression promoter of rice and its application. The promoter has the nucleotide sequence as shown in SEQ ID No.1. It is shown by means of cloning one Os252 promoter to be predicted to express in stem in high efficiency, constituting GUS fused expression vector transferred to rice and performing PCR detection and chemical GUS tissue staining, that Os252 promoter has expression in the leaf, stem and seed albumen of rice. It is shown by means of GUS enzyme activity measurement that Os252 promoter has enzyme activity in leaf and seed albumen of rice about twice that of 35S promoter and enzyme activity in stem slighter lower than that of 35S promoter, and is one high efficiency expressed promoter. The present invention may be used in the genetic improvement and production research of rice.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a rice promoter, a cloning method and an application thereof. Background technique [0002] The expression of plant genes is controlled by promoters, and the isolation and functional analysis of promoters is an important content in the study of plant gene expression regulation. Promoter refers to a DNA sequence in a gene that can combine with RNA polymerase and other trans-factors that affect transcription to accurately and effectively initiate transcription. The isolation and functional analysis of promoters is not only an important content in the study of plant gene expression regulation, but also an important aspect of plant genetic engineering research. [0003] The expression of plant genes is controlled by the promoter and has its specificity in time and space. Pathogen damage) and other inducible genes and promoters of other related genes have been studied in dep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00
Inventor 杨仲南钟晓丽李晖
Owner SHANGHAI NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap