Rice high efficient expression starter and application thereof
A high-efficiency expression and promoter technology, which is applied in the fields of application, angiosperm/flowering plants, and the introduction of foreign genetic material using vectors, can solve the problems of many copies and weak promoter expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Cloning of the promoter and construction of the vector: According to the 10 TUT data with the highest redundancy in the stem library of the Zhejiang University EST database (http: / / www.estarray.org), one of the uncloned promoters was selected, and its GenBank ID For BI807252 (ie Os252), primers were designed and synthesized: F: 5'AGTTTATGTGCTTATACAGATGAG 3'; R: 5'GGTTGAATAAGGAGGAAGC 3'. The total DNA of rice leaves was amplified by PCR, and the product fragment size was 1018bp, which was cloned into T-Vector. The binary vector pCAMBIA 1301 was digested with Hindlll and Ncol, and the large fragment was separated. After the end was filled with T4 polymerase, it was ligated with T4 ligase After constructing the pCAM-Gus vector, the T vector containing the promoter sequence was double-digested with BamH I and Sal I, and the recovered small fragment was ligated with the large fragment of the double-digested pCAM-Gus plasmid to form the rice expression vector pCAMBIA 1301. (F...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com