Two-chain small-molecular interference ribonucleic acid and its compination for treating preventing and treating AIDS

A small molecule interference, double-stranded molecule technology, applied in the field of molecular biology, can solve the problems of reduced effectiveness and failure of siRNA

Inactive Publication Date: 2007-08-29
李宝健
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The purpose of the present invention is to overcome the problem that the effectiveness of the originally designed siRNA is reduced or lost due to the mutation of the HIV-1 virus, and the following improvements have been made:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two-chain small-molecular interference ribonucleic acid and its compination for treating preventing and treating AIDS
  • Two-chain small-molecular interference ribonucleic acid and its compination for treating preventing and treating AIDS

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Design of siRNA

[0029] The present invention adopts all or most of the following principles to select target sequences and design siRNA:

[0030] 1. Select a sequence with a length of 18-25bp;

[0031] 2. Calculate the GC content and select a sequence with a GC content of about 40-55%;

[0032] 3. In more than 90% of HIV-I strains, most bases of the target sequence in the HIV-I genome are conserved; from NCBI (National Center for Biotechnology Information), EMBL (European Molecular Biology Experiment) All HIV-I genomes were downloaded from the DNA sequence database of Japan), DDBJ (DNA database of Japan) and HIV sequence database (http:∥hiv-web.lanl.gov / content / index), and after homology comparison, selected Sequence regions conserved in more than 90% of HIV-I strains serve as target sequences.

[0033] 4. The region where the target sequence is located in the HIV-I genome will not make it difficult for siRNA molecules to approach due to the formation of...

Embodiment 2

[0036] Example 2: siRNA inhibits the expression of HIV gag gene

[0037] 1. Synthesis of siRNA: Design and synthesize corresponding sense strand and antisense strand sequences according to target sequence NO.3 in Schedule 1, and obtain siRNA 3 with the following structure:

[0038] 5’ G G A G A C A U C U A U A A A A G A U dT dT 3’

[0039] | | | | | | | | | | | | | | | | | |

[0040] 3’ dT dT C C U C U G U A G A U A U U U U C U A 5’

[0041] 2. Obtaining the gag gene sequence: reverse transcription from the HIV-1 genome to generate cDNA. The cDNA was used as template (0.5ng), the conserved sequence before the 5' end of HIV-I gag gene and the EcoRI restriction site were used as forward primer (GCGAATTCGGCTAGAAGGAGAGAGATGG, 100ng), and the sequence after the 3' end of HIV-I gag gene was used as forward primer (GCGAATTCGGCTAGAAGGAGAGAGATGG, 100ng). The conserved sequence and BamHI restriction site were used as reverse primers (GCGGATCCGGGTCGTTGCCAAAGAGT, 100ng), 2.5 ...

Embodiment 3

[0045] Example 3: siRNA inhibits the expression of HIV pol gene

[0046] 1. Synthesis of siRNA: Design and synthesize the corresponding sense strand and antisense strand sequences according to the target sequence of NO.45 in Schedule 1, and obtain siRNA 45 with the following structure:

[0047] 5’ G G A C U G U C A A U G A U A U A C A dT dT 3’

[0048] | | | | | | | | | | | | | | | | | |

[0049] 3’ dT dT C C U G A C A G U U A C U A U A U G U 5’

[0050]2. Obtaining the pol gene sequence (3kb): The HIV-1 genome was reverse transcribed to generate cDNA. The cDNA was used as the template (0.5ng), the conserved sequence before the 5' end of HIV-I pol gene and the EcoRI restriction site were used as the forward primer PpolS (CGGAATTCGCAGACCAGAGCCATCAG, 100ng), and the 3' end of the pol gene of HIV-I was used as the forward primer PpolS (CGGAATTCGCAGACCAGAGCCATCAG, 100ng). The following conserved sequence and BamHI restriction site were used as the reverse primer Ppol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to double bond small molecule disturbance ribonucleic acid to prevent and cure AIDS. The double bond small molecule disturbance ribonucleic acid is RNA double bond molecule, which is called siRNA double bond molecule that has 19 base pairings. Two protrude basic groups dT are on the ends of 5' of positive bond and negative bond. GC content is 40-55%. Target sequence is gag gene, pol gene, vif gene, vpr gene, env gene, and nef gene selected from HIV gene. The positive bond sequence of siRNA double bond molecule is selected from SEQ ID NO.1-116, and the negative bond is corresponding to positive sequence. The invention conquers the problem of validity decreasing or losing effectiveness of siRNA because of the mutation of HIV-I virus.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to RNA interference technology, in particular to a double-stranded small molecule interference ribonucleic acid and a combination thereof for preventing and treating AIDS. Background technique [0002] In February 1998, Fire A et al. found that double-stranded RNA (double stranded RNA, dsRNA) could efficiently and specifically block the expression of corresponding genes in nematodes (Csenorhabditis elegans). They called this phenomenon RNA interference (RNAi for short). Subsequently, the phenomenon of RNAi was found in Drosophila, fungi, insects, plants and other organisms and mammalian cells. This widespread presence suggests that RNAi likely emerged at an early stage in the evolution of life. With the deepening of research, the mechanism of RNAi is gradually being elucidated, and it has also become a powerful tool in the field of functional genomics research, and RNAi has been paid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07H21/02A61K31/7105A61P31/18
Inventor李宝健
Owner李宝健