A-type kreotoxin receptor combination region Hc, coding protein and application thereof

A botulinum toxin type A, receptor binding technology, applied in the fields of genes and their encoded proteins and applications

Active Publication Date: 2007-10-17
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF0 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the use of DNA-based SFV replicons to develop novel nucleic acid vaccines for botulinum toxin type A has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A-type kreotoxin receptor combination region Hc, coding protein and application thereof
  • A-type kreotoxin receptor combination region Hc, coding protein and application thereof
  • A-type kreotoxin receptor combination region Hc, coding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1. Acquisition of Hc Gene HcA in Botulinum Toxin Type A Receptor Binding Region

[0051] According to the gene sequence and amino acid residue sequence (BoNT / A, A62, international standard strain, sequence number M30196) of the Hc fragment of the receptor binding region of type A botulinum toxin, the Hc gene is optimized to reduce the A and T content from 76% to 57% %, and replace rare codons with codons commonly used in Escherichia coli, while taking into account the codons commonly used in eukaryotic cells, and ensure that the encoded amino acid residue sequence remains unchanged, and then design 23 pairs (46) of primers according to the optimized gene sequence The gene fragment is artificially synthesized, and the primer sequence is as follows:

[0052] The sequences of 23 forward primers are as follows (5'-3' end):

[0053] F1 CGGAATTCACCATGGCTGAATACATCAAG

[0054] F2 AACATCATCAATACCTCCATCCTGAACCTGCGTTACGAATCCAATCACCTGATCGACCT

[0055] F3 GTCTCGTTACGCTTCC...

Embodiment 2

[0102] Example 2, Construction of prokaryotic expression vector pTIG-Trx-Hc and expression and purification of recombinant protein HcA in Escherichia coli

[0103] As shown in steps D and E in Figure 1, HcA was expressed and purified in Escherichia coli by the following method to obtain recombinant HcA:

[0104] 1. Construction of prokaryotic expression vector pTIG-Trx-Hc

[0105] Thioredoxin (Trx) is an auxiliary protein involved in the folding of the nascent protein peptide chain. When the recombinant protein HcA is co-expressed with it, it can promote the correct folding of the target protein being folded downstream through the isomerization reaction. In addition, it can also Strengthen the formation of the disulfide bond of intracellular protein, make the expression product not easy to form inclusion body, can express with soluble form, therefore construct the prokaryotic expression vector of the HcA gene containing Trx gene with the following method:

[0106] 1. Construc...

Embodiment 3

[0123] Example 3. Detection of humoral and cellular immunity levels and in vivo neutralizing activity determination after immunization of mice with recombinant HcA protein subunit vaccine

[0124] Using the purified recombinant protein HcA expressed in Example 2 as a subunit vaccine to immunize mice to detect its immunogenicity, the specific method is: Balb / c small (6-8 weeks old, female, SPF grade, purchased From the Experimental Animal Center of the Academy of Military Medical Sciences) were randomly divided into 4 groups, 6 animals in each group. Immunization groups I, II and III were immunized with 10 μg, 5 μg and 1 μg of recombinant protein HcA, respectively, while the control group was immunized with PBS without recombinant protein HcA. Before immunization, the recombinant protein HcA was dissolved in 200 μl PBS, and then mixed completely with the same dose of Freund’s complete adjuvant (Sigma Company) at a ratio of 1:1, and then subcutaneously injected into multiple poin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses A type botulin receptor binding domain Hc gene and its coding protein and uses. The gene is one of the following nucleotides sequence 1) SEQ ID NO:1 DNA sequence in sequence list, 2) SEQ ID NO:2 DNA sequence in sequence list, 3) nucleotides sequence of above 90% homology with SEQ ID NO:1 DNA sequence and capable of stimulating body to produce immune protection to A type botulin,4) nucleotides sequence capable of hybridizing with SEQ ID NO:1 DNA sequence under strict condition. The present A type botulin receptor binding domain Hc gene and its coding protein will play an important role in A type botulin vaccine.

Description

technical field [0001] The present invention relates to gene and its coded protein and application, especially relates to a type A botulinum toxin receptor binding region Hc gene and its coded protein and its application in preparing type A botulinum toxin vaccine. Background technique [0002] Botulinum toxin (BoNT) is currently the most virulent protein known, and 1.0 g of botulinum toxin crystals is enough to kill 1 million people. It is produced by Clostridium botulinum in an anaerobic environment There are 7 serotypes (A-G) of exotoxin, among which, A and B types of botulinum toxin are the common types that cause human poisoning, E and F types occasionally cause food poisoning epidemics, and C and D types only cause animal and poultry poisoning. There are fewer reports of poisoning caused by G type. Clinical observations have shown that botulinum toxin type A can cause more severe intoxication symptoms and lead to higher mortality than other types. Botulinum toxin poi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/66A61K48/00A61K39/00
Inventor俞炜源余云舟孙志伟刘志刚王双
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE