A-type kreotoxin receptor combination region Hc, coding protein and application thereof
A botulinum toxin type A, receptor binding technology, applied in the fields of genes and their encoded proteins and applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1. Acquisition of Hc Gene HcA in Botulinum Toxin Type A Receptor Binding Region
[0051] According to the gene sequence and amino acid residue sequence (BoNT / A, A62, international standard strain, sequence number M30196) of the Hc fragment of the receptor binding region of type A botulinum toxin, the Hc gene is optimized to reduce the A and T content from 76% to 57% %, and replace rare codons with codons commonly used in Escherichia coli, while taking into account the codons commonly used in eukaryotic cells, and ensure that the encoded amino acid residue sequence remains unchanged, and then design 23 pairs (46) of primers according to the optimized gene sequence The gene fragment is artificially synthesized, and the primer sequence is as follows:
[0052] The sequences of 23 forward primers are as follows (5'-3' end):
[0053] F1 CGGAATTCACCATGGCTGAATACATCAAG
[0054] F2 AACATCATCAATACCTCCATCCTGAACCTGCGTTACGAATCCAATCACCTGATCGACCT
[0055] F3 GTCTCGTTACGCTTCC...
Embodiment 2
[0102] Example 2, Construction of prokaryotic expression vector pTIG-Trx-Hc and expression and purification of recombinant protein HcA in Escherichia coli
[0103] As shown in steps D and E in Figure 1, HcA was expressed and purified in Escherichia coli by the following method to obtain recombinant HcA:
[0104] 1. Construction of prokaryotic expression vector pTIG-Trx-Hc
[0105] Thioredoxin (Trx) is an auxiliary protein involved in the folding of the nascent protein peptide chain. When the recombinant protein HcA is co-expressed with it, it can promote the correct folding of the target protein being folded downstream through the isomerization reaction. In addition, it can also Strengthen the formation of the disulfide bond of intracellular protein, make the expression product not easy to form inclusion body, can express with soluble form, therefore construct the prokaryotic expression vector of the HcA gene containing Trx gene with the following method:
[0106] 1. Construc...
Embodiment 3
[0123] Example 3. Detection of humoral and cellular immunity levels and in vivo neutralizing activity determination after immunization of mice with recombinant HcA protein subunit vaccine
[0124] Using the purified recombinant protein HcA expressed in Example 2 as a subunit vaccine to immunize mice to detect its immunogenicity, the specific method is: Balb / c small (6-8 weeks old, female, SPF grade, purchased From the Experimental Animal Center of the Academy of Military Medical Sciences) were randomly divided into 4 groups, 6 animals in each group. Immunization groups I, II and III were immunized with 10 μg, 5 μg and 1 μg of recombinant protein HcA, respectively, while the control group was immunized with PBS without recombinant protein HcA. Before immunization, the recombinant protein HcA was dissolved in 200 μl PBS, and then mixed completely with the same dose of Freund’s complete adjuvant (Sigma Company) at a ratio of 1:1, and then subcutaneously injected into multiple poin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 