Synthetic hyperglycosylated, and hyperglycosylated protease-resistant polypeptide variants, oral formulations and methods of using the same

An anti-protease and glycosylation technology, applied in the field of protein therapeutics, can solve problems such as destruction

Inactive Publication Date: 2008-01-09
ALIOS BIOPHARMA INC
View PDF238 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, oral administration of a therapeutic protein may be required to treat certain conditions; however, the therapeutic protein may be destroyed by proteolytic enzymes in the digestive tract and / or serum of the treated individual

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Synthetic hyperglycosylated, and hyperglycosylated protease-resistant polypeptide variants, oral formulations and methods of using the same
  • Synthetic hyperglycosylated, and hyperglycosylated protease-resistant polypeptide variants, oral formulations and methods of using the same
  • Synthetic hyperglycosylated, and hyperglycosylated protease-resistant polypeptide variants, oral formulations and methods of using the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1397] Example 1 : Construction of a hybrid type I interferon receptor agonist with unnatural glycosylation sites

[1398] Among type I interferons, two interferon alpha subtypes (IFN-α2b and 14), IFN-β1 and IFN-ω1 are naturally glycosylated in mammalian cells (Figure 24). Figure 24 provides a comparison of the amino acid sequence of the amino acid sequences of Infergen (SEQ ID NO: **) and type I interferon species (SEQ ID NOs: **_**), which have their natural sugars Jihua’s report. The amino acid residues where glycosylation occurs are marked with a thick box. Asparagine residues are N-linked glycosylation anchor sites, and threonine residues are O-linked glycosylation anchor sites. Most of the sequences are shown above (SEQ ID NO: **).

[1399] Based on the high degree of amino acid sequence identity between Infergen and other type I interferons, based on the amino acid sequence alignment between Infergen and naturally glycosylated type I interferons, a glycosylation site was ...

Embodiment 2

[1409] Example 2 : Design, construction, expression and glycosylation site generation of fusion constructs of mammalian Infergen and other type I interferon signal peptides.

[1410] Materials and methods

[1411] Construction of Fusion Gene

[1412] The amino acid alignment of Infergen and an exemplary Infergen fusion protein and human Infergen α14 and β are shown in FIG. 30. In order to synthesize a fusion gene for a predetermined fusion protein, a two-step polymerase chain reaction strategy was designed. The primers used in the PCR reaction are listed in Table 12 below:

[1413] Table 12

[1414] Primer name

Sequence (5′ to 3′)

IFNa14_Inner

GCCCFGGTGGTGCTGAGCTGCAAGAGCAGC-

TGCAGCCTGGGCTGCGACCTGCCCCAGACCCACAGC (SEQ ID

NO:1350)

IFNa14_Outer

TATAAAGCTTGCCACCATGGCCCTGCCCTTC-

GCCCTGATGATGGCCCTGGTGGTGCTTGAGCTGCAAG (SEQ ID

NO:1351)

IFNb_Inner

GCCCTGCTGCTGTGCTTCAGCACCACCGCCC-

TGAGCATGAGCTGCGACCTGCCCCAGACCCACAGC (SEQ ID...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention provides synthetic Type I interferon receptor polypeptide agonists comprising consensus or hybrid Type I interferon receptor polypeptide agonists, containing one or more native or non-native glycosylation sites. The present invention further provides oral formulations of protease-resistant or protease-resistant, hyperglycosylated polypeptide variants, which polypeptide variants lack at least one protease cleavage site found in a parent polypeptide, and thus exhibit increased protease resistance compared to the parent polypeptide, which polypeptide variants further include (1) a carbohydrate moiety covalently linked to at least one non-native glycosylation site not found in the parent protein therapeutic or (2) a carbohydrate moiety covalently linked to at least one native glycosylation site found but not glycosylated in the parent protein therapeutic. The present invention further provides compositions, including oral pharmaceutical compositions, comprising the synthetic Type I interferon receptor polypeptide agonist, the hyperglycosylated polypeptide variant, the protease-resistant polypeptide variant, or the hyperglycosylated, protease-resistant polypeptide variant. The present invention further provides containers, devices, and kits comprising the synthetic Type I interferon receptor polypeptide agonist, the hyperglycosylated polypeptide variant, the protease-resistant polypeptide variant, or the hyperglycosylated, protease-resistant polypeptide variant. The present invention further provides therapeutic methods involving administering an effective amount of an oral pharmaceutical composition comprising a synthetic Type I interferon receptor polypeptide agonist, a hyperglycosylated polypeptide variant, a protease-resistant polypeptide variant, or a hyperglycosylated, protease-resistant polypeptide variant to an individual in need thereof.

Description

Technical field [0001] The present invention relates to glycosylated, anti-protease and glycosylated, anti-protease protein therapeutics. Background of the invention [0002] Protein has received clinical attention as a therapeutic agent. Nevertheless, its application still has various obstacles and shortcomings, including immunogenicity; the therapeutic protein is destroyed by enzymes produced by the host; non-optimal pharmacokinetic characteristics; and similar problems. For example, the immunogenicity of a therapeutic protein can result in the activity of the protein being eliminated by neutralizing antibodies produced over time in the subject. In addition, the immunogenicity of therapeutic proteins can lead to inflammatory reactions. The destruction of therapeutic proteins by host enzymes may preclude the use of certain routes of administration. For example, treatment of certain conditions may require oral therapeutic protein; however, the therapeutic protein may be destroyed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K38/21
Inventor洪劲司各特·D·塞尔沃特劳伦斯·M·布拉特
OwnerALIOS BIOPHARMA INC