Recombined bifidobacteria hRV-VP4 expression vector and oral administration vaccine thereof

A bifidobacteria and expression vector technology, applied in the field of genetic engineering, can solve the problems of bifidobacteria that have not been reported, and achieve the effects of high safety and broad clinical application prospects.

Inactive Publication Date: 2008-07-16
CHONGQING MEDICAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, the use of bifidobacteria to express recombinant RV virus proteins and prepare live vaccines has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined bifidobacteria hRV-VP4 expression vector and oral administration vaccine thereof
  • Recombined bifidobacteria hRV-VP4 expression vector and oral administration vaccine thereof
  • Recombined bifidobacteria hRV-VP4 expression vector and oral administration vaccine thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of Bifidobacterium-Escherichia coli shuttle expression vector of the present invention

[0035] 1. replace the Ptac promoter (183-932) on the pGEX-5x-1 with the promoter AmyO (position: 599-690nt) of the α-amylase (amylase) gene (GenBank No: AY240946) of bifidobacteria, and simultaneously The LacIq fragment (position: 3301-4420nt) on pGEX-5x-1 was deleted by PCR method.

[0036] Specific steps are as follows:

[0037] 1. Using the pGEX-5x-1 plasmid as a template, use high-fidelity Taq DNA polymerase to obtain the basic skeleton of the vector by PCR amplification.

[0038] PCR primer F is the multiple cloning site (MCS) sequence on pGEX-5x-1, and primer R is the upstream sequence of LacIq. is the primer sequence for deleting LacIq on pGEX-5x-1.

[0039] The primer sequences are as follows: pF1: ggatcc ccgaattcccg (SEQ ID NO.4) (position: pGEX-5x-1934-949, containing the added BamHI restriction site);

[0040] pR1: ccgcgg attcaccaccctgaa...

Embodiment 2

[0063] Embodiment two constructs pBEX-hRV VP4 expression vector (process schematic diagram sees attached image 3 )

[0064] 1. Amplify the viral protein VP4 gene (GENBANK NO.L34161, coding position: 10-2337nt, as shown in SEQ ID NO.2) from the genome of Wa strain hRV virus by RT-PCR method.

[0065] Primers are as follows:

[0066] Vp4 F: ggatccggctataaaatggcttcact (SEQ ID NO. 13) (BamHI site added).

[0067] Vp4 R: gtcgaccacatcctcaatagcgttct (SEQ ID NO. 14) (SalI site added).

[0068] Methods as below:

[0069] Take 10 μl of extracted RNA, heat at 100°C for 2 minutes to denature the double-stranded RNA, and then centrifuge briefly after 2 minutes on ice, then add 4 μl of 5×AMV Bufer, 2 μl of dNTPs, 1 μl of downstream primer (30 μM / μl), 1 μl of RNasin, and reverse Transcriptase AMV 2μl, add ddH20 to make up the 25μl reaction system.

[0070] Reverse transcription at 42°C for 1 hour. Take a clean and sterilized PCR tube and add to the 50 μl reaction system: 5 μl of 10×PC...

Embodiment 3

[0072] Embodiment 3 The preparation of the bifidobacterium seed bacteria containing pBEX-hRV-VP4 recombinant vector of the present invention

[0073] The procedure for transforming bifidobacteria is as follows:

[0074] 1. Select Bifidobacteria with an OD value of 0.6 as the recipient bacteria. After being treated with sterilized 10% glycerol prepared in deionized water, the plasmid vector is transformed into the recipient bacteria by electroporation; the transformation conditions are: 15KV, 200Ω , 25μF.

[0075] 2. Resuscitate the transformed bifidobacteria in MRS liquid medium without antibiotics for 60-120 minutes, and then culture them on MRS solid medium containing 50 μg / ml ampicillin to select resistant colonies to obtain transformed hRV - the bifidobacterium of VP4 gene, the positive clone after PCR and SDS-PAGE identification is the bifidobacterium seed fungus containing the pBEX-hRV VP4 recombinant vector.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention pertains to the field of genetic engineering, which more particularly relates to a recombinant bifidobacterium hRV-VP4 expression vector and the oral vaccine. The technical problem to be solved is to construct a bifidobacterium expression vector of hRV virus VP4 protein. The recombinant bifidobacterium hRV-VP4 expression vector of the invention is loaded with a virus protein VP4 coding gene sequence of a human group A rotavirus. The expression vector of the invention can be transfected into the bifidobacterium and can be further prepared into an hRV-VP4 transgenic bifidobacterium-hRV-VP4 recombinant vector oral live vaccine preparation after fermentation culture. The invention is mainly used for the prevention and adjuvant treatment of infantile diarrhea which is caused by human rotavirus, thus having great market prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a recombinant bifidobacterium hRV-VP4 expression vector and an oral vaccine thereof. Background technique [0002] Human group A rotavirus (human rotavirus, hRV) is the main pathogen that causes severe diarrhea in newborns. About 60% of severe diarrhea is caused by RV. About 500,000 infants and young children in the world die every year due to RV infection. Therefore, WHO prioritizes RV vaccine research [1] . [0003] At present, the main direction of RV vaccine research is the artificially reassorted attenuated oral live vaccine, wherein the oral vaccine produced by Wyeth-Ayerst Company is the most influential, but it will withdraw from the market soon due to safety problems (trade name Rotashield?, June 1999 Voluntarily withdrawn due to intussusception [1] ). Another RIX4414 in the past 2 years [12-13] and RotaTeq [14] Phase 3 clinical trials have been repor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N15/46C12N1/21A61K9/08A61K9/20A61K9/48A61K39/15A61K39/39A61P31/14A61P1/12C12R1/01
Inventor马永平
OwnerCHONGQING MEDICAL UNIVERSITY