Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing evoked pluripotent stem cell

A technology of pluripotent stem cells and embryonic stem cells, applied in the field of biomedicine, can solve problems such as low efficiency, affecting application and promotion, and achieve high efficiency

Inactive Publication Date: 2008-08-27
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Low efficiency will seriously affect its application and promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing evoked pluripotent stem cell
  • Method for preparing evoked pluripotent stem cell
  • Method for preparing evoked pluripotent stem cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Preparation of Example 1 Class Embryonic Stem Cells

[0055] Coding regions of specific genes (Oct4, Nanog, Sox2, Lin28, c-myc, and Klf4) were amplified by polymerase chain reaction (PCR) from total human cDNA, and ligated into lentiviral vectors (construct Such as Figure 7 Shown, Invitrogen Company), so that it can be brought into cells by the produced lentivirus for expression. Oct-4 (also known as Oct-3, Pou5Fl), GenBank accession number is NM_002701; Nanog, GenBank accession number is NP_079141; Sox2, GenBank accession number is NP_003097; Lin28, GenBank accession number is NP_078950; is NP_002458; Klf4, GenBank accession number is NP_004226. Amplification primers are listed in Table 1:

[0056] Primer name

Primer sequence

lin28 5' primer SEQ ID NO: 1

atgggctccgtgtccaaccag

lin28 3' primer SEQ ID NO: 2

tcaattctgtgcctccggggag

C-myc 5' primer SEQ ID NO: 3

atgcccctcaacgttagcttca

C-myc 3' primer SEQ ID NO: 4

tt...

Embodiment 2

[0071] The mensuration of embodiment 2 alkaline phosphatase

[0072] 1. Purpose: To identify whether the formed clone has the characteristics of embryonic stem cells by detecting the activity of alkaline phosphatase, and compare the results of the two experimental groups

[0073] 2. Method

[0074] For the experimental group transferred with 4 factors in Example 1, clones were picked on the 26th day; while for the experimental group transferred with 6 factors, clones were picked on the 17th day, which is called iPS-S. The selected clones were cultured on mouse embryonic fibroblast trophoblasts using standard human embryonic stem cell culture media and methods (Thomson JA, Itskovitz-Eldor J, ShapiroSS, et al. Embryonic stem cell lines derived from human blastocysts.Science.Nov 61998; 282(5391):1145-1147) In order to quantify the efficiency of reprogramming, we selected a bottle of cells in each experiment and fixed them on day 17, and detected their alkaline phosphatase expre...

Embodiment 3

[0079] The determination of embodiment 3 specific surface antigen

[0080] 1. Purpose: To further identify whether the obtained clone has the characteristics of embryonic stem cells by detecting whether it has the specific surface antigen of embryonic stem cells.

[0081] 2. Method

[0082] Using literature (Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts. Science. Nov 6 1998; 282(5391): 1145-1147 and Xiao L, Yuan X, SharkisSJ. Activin A Maintains self-renewal and regulates fibroblast growth factor, Wnt, and bonemorphogenic protein pathways in human embryonic stem cells.Stem Cells.Jun2006; 24 (6): 1476-1486), respectively detect the embodiment by immunofluorescence 1 The expression of SSEA-3, SSEA-4, Tra-1-60, and Tra-1-81, which are specific surface antigens of embryonic stem cells, in the obtained clones.

[0083] 3. Results

[0084] The iPS cells produced in this experiment were positive for SSEA-3, SSEA-4, Tra-1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing induced embryonic stem cells, which comprises following steps: firstly, introducing six transcription factors into adult cells, secondly, culturing the adult cells under the condition for culturing the embryonic stem cells, and enabling the adult cells to form cells with the form of embryonic stem cells. The method of the invention also comprises: cloning the six transcription factors into a carrier and then transforming the six transcription factors into the adult cells. When the method of the invention is adopted to prepare the embryonic stem cells, the efficiency is high, the acute rejection can be avoided, the embryonic stem cells can be differentiated into different tissue cells under special conditions, and the method of the invention has wide applying prospect.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a method for preparing induced pluripotent stem cells (Induced pluripotent stem cells, referred to as iPS cells). Background technique [0002] Human embryonic stem cells have the potential to differentiate into various types of human cells, and provide the possibility of application for regenerative medicine (Thomson JA., Itskovitz-Eldor J., Shapiro SS., et al.Science.Nov 6 1998; 282( 5391): 1145-1147). However, immune rejection has a great influence on the transplantation therapy of human embryonic stem cells. In order to be able to cultivate patient-specific pluripotent stem cells to eliminate the impact of immune rejection, people have tried many methods, such as nuclear transfer of adult cells (also known as therapeutic cloning), fusion of adult cells and human embryonic stem cells, etc. , but were not successful. The possibility of obtaining patient-specific induce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/11C12N15/63A61K35/12A61P37/00A61K35/545
Inventor 肖磊廖婧吴昭
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI