Fusion protein for serum albumin and interleukin 1 receptor antagonist and uses thereof

A receptor antagonist, serum albumin technology, applied in the field of fusion protein of serum albumin and interleukin 1 receptor antagonist, can solve the problems of increasing patient suffering and treatment costs, short plasma half-life, toxic and side effects, etc., to achieve It is beneficial to the development of industrialization, reduces the frequency of injection, and prolongs the effect of half-life

Active Publication Date: 2012-01-25
HISUN BIORAY PHARMA CO LTD +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Due to the small molecular weight of IL1ra, it is easy to be filtered by the glomerulus. Therefore, in clinical application, the plasma half-life is short, and it generally requires frequent medication in large doses, such as 2-3 times a week. When IL1ra treats rheumatoid arthritis, the treatment The cycle is often as long as several months or even years. This long-term high-dose frequent medication not only increases the patient's pain and treatment costs, but also easily produces toxic and side effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein for serum albumin and interleukin 1 receptor antagonist and uses thereof
  • Fusion protein for serum albumin and interleukin 1 receptor antagonist and uses thereof
  • Fusion protein for serum albumin and interleukin 1 receptor antagonist and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Cloning of HSA cDNA

[0038] HSAcDNA without signal peptide coding sequence was obtained from human liver fetal cDNA library by PCR method, and the primers HSA up (SEQ ID NO: 1) and HSA dn (SEQ ID NO: 2) were synthesized with oligonucleotides The upstream and downstream primers were respectively introduced into EcoRI and BamHI sites and protective bases, and the underlined part was the endonuclease recognition sequence.

[0039] HSA-up: 5'ATGC GAATTC GATGCACACAAGAGTGAGGTT 3'

[0040] HSA-down: 5'ATGC GGATCC TAAGCCTAAGGCAGCTTGACT 3’

[0041] PCR reaction conditions: In 100 μL reaction system, add 1.5 μL liver tissue cDNA, 20 μmol / L upstream and downstream primers 1.5 μL each, 10 mmol / L dNTP (deoxynucleotide) 1 μL, 10× reaction buffer 10 μL, Taq DNA polymerization Enzyme 0.5 μL, the rest with ddH 2 O make up. Use EPPENDORF company (model Matstercycler Gradient) PCR instrument, PCR reaction conditions are 94°C pre-denaturation for 5 minutes; 94°C denatur...

Embodiment 2

[0043] Example 2: Cloning of IL1ra cDNA

[0044] The IL1ra cDNA gene sequence was obtained from human liver by RT-PCR method, and the primers IL1raup (SEQ ID NO: 3) and IL1ra dn (SEQ ID NO: 4) used were synthesized with an oligonucleotide synthesizer, and IL1ra up 5 A BamHI restriction site was added to the 'end, so that the HSA gene and the IL1ra gene could be fused by BamHI digestion and ligation. An EcoRI restriction site was designed at the 5' end of IL1ra dn for ligation with the selected pPIC9 vector. The underline is the endonuclease recognition sequence.

[0045] IL1ra up: 5′-CC GGATCC CG AC CC TCTG GG AGAAAATC-3′

[0046] IL1ra dn:5′-GCA GAATTC CTACTCGTCCTCCTGGA-3′

[0047] PCR reaction conditions: In 100 μL reaction system, add 1.5 μL liver tissue cDNA, 20 μmol / L upstream and downstream primers 1.5 μL each, 10 mmol / L dNTP (deoxynucleotide) 1 μL, 10× reaction buffer 10 μL, Taq DNA polymerization Enzyme 0.5 μL, the rest with ddH 2 O make up. Use EPPENDORF co...

Embodiment 3

[0049] Example 3: Expression of fusion proteins without linker peptides

[0050] For the secreted expression of HSA and IL1ra as a directly linked fusion protein from Pichia pastoris, see figure 1 , select the pPIC9 plasmid as the vector (Invitrogen Corp. USA), and insert the fusion protein gene between the XhoI and EcoRI sites downstream of the AoX promoter of the vector.

[0051] Obtain the modified HSA, the cDNA of IL1ra from the PGEM-T-HSA, PGEM-T-IL1ra that embodiment 1,2 constructs with the PCR method similar to embodiment 1,2, used primer is changed into HSA 1 (SEQ ID NO: 5), HSA 2 (SEQ ID NO: 6) and IL1ra 1 (SEQ ID NO: 7), IL1ra 2 (SEQ ID NO: 8).

[0052] HSA 1: 5'-GC ctcgag (XhoI) GATGCACACAAGAGTGAGG-3'

[0053] HSA 2: 5'-GGATTTTCTCCCAGAGGGTCG (IL1ra sequence)

[0054] TAAGCCTAAGGCAGCTTGAC(HSA sequence)-3'

[0055] IL1ra 1: 5′-GTCAAGCTGCCTTAGGCTTA (HSA sequence)

[0056] CGACCCTCTGGGAGAAAATCCAGCAA (IL1ra sequence)-3'

[0057] IL1ra 2: 5'-GCA gaattc(EcoRI)CTACT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a amalgamation albumen of serum albumin and interleukin 1 receptor antagonist, comprising human serum albumin HAS, peptide joint and human interleukin1 receptor antagonist IL1ra, wherein the peptide joint is 0-20 aminophenol long and exists between human HSA and human IL1ra, the construct is [GlyGlyGlyGlyser]<n>, n represents an integer from 0 to 4. The amalgamation albumen is obtained by constructing recombination pichia cell line, inducing expression of recombination amalgamation albumen in a growth culture medium and purifying. The amalgamation albumen, on the basis of original vivo and vitro biology function, reduces the clearance of IL1ra in vivo, prolongs the half-life of IL1ra in vivo, decreases dose and ejection frequency, make the maximum treat action, reduces the potential side effect of IL1ra or toxicity, improves safety and tolerance, is substantial an aid to treat moderate and bad rheumatoid arthritis, and can be used in the preparation of interleukin receptor antagonist.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fusion protein of serum albumin and an interleukin-1 receptor antagonist with improved biological half-life. technical background [0002] Serum albumin is an important component of plasma, and is also the carrier of many endogenous factors and exogenous drugs, and it is difficult to penetrate the glomerulus under normal circumstances. Human serum albumin (sequence 1) is a protein composed of 585 amino acid residues (A.Dugaiczyk et al., PNAS, 1982 79:71-75), its molecular weight is about 66.5KD, and its plasma half-life is as long as 2 weeks above. [0003] Human serum albumin (HSA) is synthesized in cells in the form of a propeptide containing a signal peptide of 18 amino acid residues and 6 propeptides, which are excised during transport and secretion. Human serum albumin has been successfully expressed in various hosts (EP330451 and EP361991). [0004] Interleukin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81A61K38/38A61P19/02A61P29/00A61K38/17
Inventor陈枢青戴寿沣陈静
OwnerHISUN BIORAY PHARMA CO LTD