Pig muscle quality correlated numerator mark CSRP3 clone and application thereof

A molecular marker and muscle quality technology, applied in the field of livestock genetic engineering, can solve the problem of insufficient number of genes

Inactive Publication Date: 2008-12-10
HUAZHONG AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the QTLs that have been mapped, the number of genes that have identified causative mutations or found that there are related genes is far from enough, indicating that a large number of genes related to muscle quality need to be further identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig muscle quality correlated numerator mark CSRP3 clone and application thereof
  • Pig muscle quality correlated numerator mark CSRP3 clone and application thereof
  • Pig muscle quality correlated numerator mark CSRP3 clone and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Nucleotide sequence cloning of embodiment 1 CSRP3 gene

[0023] 1. cDNA cloning of CSRP3 gene

[0024] (1) Primer design

[0025] Using the reported mRNA sequence of the human CSRP3 gene (GenBank accession number: NM_003476.2) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank pig EST database, a series of 90% homology was obtained The above ESTs (fragment length greater than 100bp), using the SeqMan program in DNAStar software to construct the porcine CSRP3 gene EST-contig, based on which the 5'RACE outer primer P-5O, 5'RACE inner primer P-5I, 3' RACE outer primer P-3O and 3'RACE inner primer P-3I, the primer DNA sequences are shown in Table 1:

[0026] Table 1: Design of primer sequences for cDNA cloning of CSRP3 gene

[0027]

[0028] (2) RACE amplification

[0029] Referring to the instructions of the TriZoL kit (product of GIBCO, USA), the kit was used to extract total RNA from the muscle tissue of adult landr...

Embodiment 2

[0043] Example 2 Association Analysis of CSRP3 Gene C1924T TaqI PCR-RFLP Genotype and Meat Quality Traits

[0044] 1. Establishment of TaqI PCR-RFLP detection method

[0045] (1) Primer sequence

[0046] CRP3-E4-S: 5′GGTACTGTTCGCCAAGGAGA 3′

[0047] CRP3-E4-R: 5′ TCCAGGAAAGTGGGTGAAGA 3′

[0048] (2) PCR amplification conditions

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the livestock gene engineering technical field, in particular relating to a molecular marker GSRP3 and an application thereof, wherein, the molecular marker GSRP3 is applied as porcine marker-assisted selection and relates to quality properties of porcine muscle. The molecular marker is produced by cloning a CSRP3 gene, and a cDNA sequence of the molecular marker is shown in a sequence table SEQ ID NO: 1. A base substitution of C1924-T1924 exists at 1924bpth of a sequence table SEQ ID NO: 2, and leads to the enzyme digestion polymorphism of TaqI PCR-RFLP. The invention also discloses a primer used for amplifying an intact cDNA sequence and a partial DNA sequence of the CSRP3 gene and a method for polymorphic detection, and provides a novel molecular marker for the porcine marker-assisted selection.

Description

technical field [0001] The invention belongs to the technical field of livestock genetic engineering, and in particular relates to the cloning and application of a molecular marker CSRP3 related to pig muscle quality. Background technique [0002] Pork is the main source of animal protein for our people. In the past few decades, with the introduction of high-lean meat percentage and fast-growing breeding pigs from abroad, my country's pork production has gradually met the market demand in terms of quantity. However, breeding pigs bred with overselection for leanness and growth velocity are inferior to Chinese local pigs in terms of muscle quality. With the improvement of living standards and the change of consumption concept, lean meat with good color, aroma and taste, safe and nutritious is more and more favored by consumers. Therefore, the improvement of muscle quality has become an important goal of high-quality pig breeding work, and the search for related molecular ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/12C12N15/11C12N15/10
Inventor 刘榜徐学文李奎樊斌朱猛进余梅
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products