Mark of tender Ganoderma seed strain or fruiting body molecule thereof, and acquisition method and application thereof

Abstract

The invention relates to a mark of a tender Ganoderma seed strain or a fruiting body molecule thereof, and an acquisition method and application thereof. The mark is a 469bp special DNA segment after PCR is amplified, and the sequences of a PCR amplimer pair are 5'cgtcgtaaagcgagtctcttc 3' and 5'-ggtcataaagttgtcccagac 3'. The acquisition method comprises the following steps: 1) extracting genome DNA of the strain or a fruiting body; 2) obtaining the special DNA segment; 3) obtaining a special PCR amplimer; 4) amplifying the genome DNA of the strain or the fruiting body by the special PCR amplimer; and 5) performing agarose gel electrophoresis detection. The mark is used for rapidly identifying or detecting the genuineness of the tender Ganoderma seed strain and Ganoderma lucidun products in the market. Compared with the conventional morphological detection, antagonism experiment and primodium test, the method has the advantages of short detection time and high accuracy.

Description

technical field [0001] The invention belongs to the field of identification of ganoderma lucidum strains, and in particular relates to a specific molecular marker of Bozhi lucidum strains or fruiting bodies, an obtaining method and application thereof. Background technique [0002] Bozhiren Miwen treats neurasthenia, heart palpitations, insomnia, acute hepatitis and chronic hepatitis. [0003] With the continuous understanding of the biological efficacy of Ganoderma lucidum, more and more products have been developed using it as raw materials, and the sales volume is also increasing. The quality of Ganoderma lucidum raw materials has been paid more and more attention. In recent years, with the commercialization of various products of Ganoderma lucidum, the rapid development of Ganoderma lucidum cultivation and production in China has been greatly promoted. At the same time, the germplasm resources of Ganoderma lucidum are also expanding. The strains used for the production ...

AI Technical Summary

Problems solved by technology

In recent years, with the commercialization of various products of Ganoderma lucidum, the rapid development of Ganoderma lucidum cultivation and production in China has been greatly promoted. At the same time, the germplasm resources of Ganoderma lucidum are also expanding. The strains used for the production of Ganoderma lucidum are relatively confusing, and the phenomenon of the same species with different names and different names and the same species is very common in cultivation and production. Related industries have caused certain economic losses

Nowadays, the quality of ganoderma lucidum products in my country is difficult to stabilize due to strain problems, and it also seriously restricts the pace of ganoderma lucidum products going abroad and entering the international market.

[0004] The traditional classification and identification are mainly based on the morphological characteristics of the fruiting body, including the size of the basidiospore and the morphological characteristics of the dermal hyphae of the fruiting body. However, many morphological characteristics of the fruiting body often change with different growth conditions, and many Distinguishing characteristics are often shared by several species, which brings great difficulties to traditional taxonomy. It is not very reliable to identify strains based solely on morphological characteristics

Images