Mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof
A growth factor, antigen epitope technology, applied in the field of molecular biology, can solve the problems of high artificial synthesis cost and no obvious homology.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] (1) By bioinformatics methods, the nucleotide sequence of the simulated short peptide 12B obtained by simulating the endothelial cell growth factor VEGF epitope is as follows:
[0024] AAAGCTCGTCAGCTGGAACTGAACGAACGTACCTGCCGTTGCGACAAA;
[0025] (2) In order to efficiently construct the short analog peptide 12B with only 48 bases on the phage vector pCANTAB5-E, firstly design primer 1 and primer 2 according to the base sequence and restriction site on pCANTAB5-E for the second step One round of PCR, the two PCR products were used as templates for the second round of PCR. Then, according to the base sequence of the simulated short peptide 12B and the base sequence of the product obtained in the first round of PCR, primers A and B were designed, and the second round of PCR was carried out. The amplified product with a base length of 100-200 bp and containing the simulated short peptide 12B was used for the next experiment.
[0026] Primer 1: AAGCTTTGGAGCCTTTTTTTTGGAGATTTT...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com