Unlock instant, AI-driven research and patent intelligence for your innovation.

Mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof

A growth factor, antigen epitope technology, applied in the field of molecular biology, can solve the problems of high artificial synthesis cost and no obvious homology.

Inactive Publication Date: 2010-09-22
JINAN UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Among the current peptide drugs, in terms of anti-tumor, Kathleen et al. synthesized two peptides through artificial chemistry. The results showed that the peptide had a high inhibitory rate on human cervical cancer cells, but the peptide had no significant effect on human VEGF. Homology, and the conserved motif MXXP with anti-tumor activity obtained by Maruta et al. has no homology with FGFs
The artificial synthesis of these peptides is expensive, and if used as a vaccine, it may induce the production of antibodies specific to the peptide in the human body, thereby preventing its anti-tumor effect from being exerted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof
  • Mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof
  • Mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] (1) By bioinformatics methods, the nucleotide sequence of the simulated short peptide 12B obtained by simulating the endothelial cell growth factor VEGF epitope is as follows:

[0024] AAAGCTCGTCAGCTGGAACTGAACGAACGTACCTGCCGTTGCGACAAA;

[0025] (2) In order to efficiently construct the short analog peptide 12B with only 48 bases on the phage vector pCANTAB5-E, firstly design primer 1 and primer 2 according to the base sequence and restriction site on pCANTAB5-E for the second step One round of PCR, the two PCR products were used as templates for the second round of PCR. Then, according to the base sequence of the simulated short peptide 12B and the base sequence of the product obtained in the first round of PCR, primers A and B were designed, and the second round of PCR was carried out. The amplified product with a base length of 100-200 bp and containing the simulated short peptide 12B was used for the next experiment.

[0026] Primer 1: AAGCTTTGGAGCCTTTTTTTTGGAGATTTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mimic short peptide 12B of endothelial cell growth factor VEGF antigen epitope and an application thereof. The amino acid sequence of the mimic short peptide 12B is KARQLELNERTCRCDK and the nucleotide sequence is AAAGCTCGTCAGCTGGAACTGAACGAACGTACCTGCCGTTGCGACAAA. In vitro experiments show that the mimic short peptide 12B of the invention has obvious inhibiting effect during the processes of endothelial cell proliferation and tube formation and the tumor cell proliferation and migration. Therefore, the mimic short peptide 12B of the invention can be used for preparing peptide vaccines, tumor angiogenesis inhibitor or tumor-oriented drugs, and has significant reference value on diagnosing and predicting tumor tumorigenesis by utilizing VEGF receptor as a target, discussing development of small molecular peptides on the tumor angiogenesis inhibitors, and developing and researching tumor-oriented drugs.

Description

technical field [0001] The invention belongs to the fields of molecular biology and medicine, in particular to a short analog peptide 12B of endothelial cell growth factor VEGF antigen epitope and application thereof. Background technique [0002] VEGF is a homodimeric protein with a relative molecular weight of 34-42KD that was first purified by Ferrara in the in vitro culture medium of bovine pituitary follicular astrocytes in 1989. The human VEGF gene structure is located on chromosome 6p21.3, consisting of 8 exons and 7 introns alternately. According to the splicing mode of its mRNA, five different VEGF isoforms are produced, including VEGF206, VEGF189, VEGF165, VEGF145 and VEGF121. These 5 isomers of VEGF all have the activity of inducing endothelial cell proliferation and are effective angiogenesis and permeability inducing factors. The difference mainly lies in their affinity with heparin on the cell surface and in the extracellular matrix. [0003] VEGF acts by bin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/08C12N15/12A61K38/10A61K39/00A61P35/00
Inventor 邓宁王宏赵鑫
Owner JINAN UNIVERSITY