Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D

A Salmonella and identification method technology, applied in the field of multiplex PCR identification, can solve the problems of difficulty in designing multiple primers, high identification cost, etc., and achieve the effects of simple result determination, short detection time, and specific detection results.

Active Publication Date: 2010-11-24
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the antigenic structure of Salmonella is polymorphic, the gene sequences in the corresponding rfb gene clusters are also different in sequence, deletion, and mutation among the various Salmonel...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D
  • Multiple PCR identification method of salmonella serogroup A, B, C1, C2 or D

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] Step 1: Select target and design primers

[0039] (1) Through bioinformatics analysis, the specific target of Salmonella serogroup A found is a DNA sequence (SEQ ID NO: 1) from the complete genome sequence of paratyphoid A strain ATCC9150 (SEQ ID NO: 1), using primer design software Primer Premier 5.0 designs a pair of identification primers for serogroup A in this DNA sequence segment.

[0040] The primer sequences are as follows:

[0041] SA-L: AACAGATCCTGCACCATATC; (SEQ ID NO: 6)

[0042] SA-R: CAGTTTCATGATGGCAGAG; (SEQ ID NO: 7)

[0043](2) Through bioinformatics analysis, the specific target of Salmonella serogroup B found is the gene STM2087 (SEQ ID NO: 2), and a pair of serogroup B was designed in this gene sequence segment using the primer design software Primer Premier 5.0 identification primers.

[0044] The primer sequences are as follows:

[0045] SB-L: CGATGAGGGTTTCTAATCTC; (SEQ ID NO: 8)

[0046] SB-R: TCTTGCTTCAGTATCCCTTG; (SEQ ID NO: 9)

[0047] (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a multiple PCR identification method of salmonella serogroups A, B, C1, C2 or D, belonging to the technical field of food safety detection. The method comprises the following steps: step 1: respectively designing specific amplification primer pairs according to a base sequence such as 5 nucleic acids as shown in SEQ ID NO:1-5; and step 2: detecting a sample by utilizing the specific amplification primer pairs obtained in the step 1 and adopting a conventional PCR method, and determining the type of the salmonella serogroup in the sample. The determined type of the salmonella serogroup in the sample is concretely as follows: the gel electrophoresis detection is carried out, wherein if 350bp and 466bp bands exist, the result shows that the serogroup A exists; if 177bp bands exist, the result shows that the serogroup B exists; if 623bp bands exist, the result shows that the serogroup C1 exists; if 540bp bands exist, the result shows that the serogroup C2 exists; and if 466bp bands exist, the result shows that the serogroup D exists. The method of the invention can be used for quickly and accurately identifying the salmonella of the serogroups A, B, C1, C2 or D, and avoids the defects of complicated operation, time and labor consumption and high cost of the existing method.

Description

technical field [0001] The invention relates to a multiplex PCR identification method in the technical field of food safety detection, in particular to a multiplex PCR identification method for Salmonella serogroups A, B, C1, C2 and D. Background technique [0002] Salmonella is one of the most important food-borne pathogens, which can be transmitted through food (especially animal food), and can cause human gastroenteritis, sepsis, dysentery and typhoid fever. Serotyping is the core of its identification research in the study of Salmonella epidemiology, and plays an important role in monitoring disease outbreaks, transmission trends and disease control. At present, there are more than 2,500 serotypes of Salmonella isolated in the world, and there are about 300 serotypes in my country, but the serotypes related to human diseases are mainly concentrated in A~E serogroups, and the pathogenic Salmonella in A~D groups account for the majority. to 70%. [0003] In practice, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11C12N15/31
CPCY02A50/30
Inventor 史贤明刘斌施春雷
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products