Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method
A double anti-sandwich, Toxoplasma gondii technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as false negatives, inability to determine current infection or past infection, and low immune function.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] The preparation of embodiment 1 recombinant protein MIC-10A
[0049] 1) Artificially synthesize the following primers:
[0050] FW: GATC GGATCC GATTTTTTTAACGATTAC
[0051] RV: GATC AAGCTT TCATTCACGAAGTCCTCTTTTC
[0052] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6min. , to obtain the MIC-10A gene fragment, see attached figure 1 , cloned into the PMD-18T vector, identified by enzyme digestion, see the attached figure 2 , the nucleotide sequence of which is shown in SEQ ID No.1;
[0053] 3) Insert the MIC10A gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10A;
[0054] 4) Transfer the recombinant expression plasmid PET28A-MIC1...
Embodiment 2
[0055] The preparation of embodiment 2 recombinant protein MIC-10B
[0056] 1) Artificially synthesize the following primers:
[0057] FW: GATCGGATCCGCCGCTGAGCGTGAGGAGAAG
[0058] RV: GATCAAGCTTTCACATTGATTTCCTGCG
[0059] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6 minutes to obtain the MIC-10B gene fragment, see attached figure 1 , cloned into the PMD-18T vector, identified by enzyme digestion, see the attached figure 2 , the nucleotide sequence of which is shown in SEQ ID No.2;
[0060] 3) Insert the MIC10B gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10B; figure 2 ;
[0061] 4) Transfer the recombinant expression plasmid PET28A...
Embodiment 3
[0062] Example 3 Preparation of recombinant fusion protein MIC-10C
[0063] 1) Artificially synthesize the following primers:
[0064] FW: GATCGGATCCGATTTTTTTAACGATTAC
[0065] RV: GATCAAGCTTTCACATTGATTTCCTGCG
[0066] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6 minutes to obtain the MIC10C gene fragment; cloned into the PMD-18T vector, identified by enzyme digestion, and its nucleotide sequence is shown in SEQ ID No.2;
[0067] 3) Insert the MIC10C gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10C;
[0068] 4) Transfer the recombinant expression plasmid PET28A-MIC-10C into BL21(DE3) for expression to obtain the recombinant fusion prote...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com