Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method

A double anti-sandwich, Toxoplasma gondii technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as false negatives, inability to determine current infection or past infection, and low immune function.

Inactive Publication Date: 2011-04-13
JILIN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The biggest disadvantage of IgG testing is that it cannot determine whether it is current infection or past infection
IgM testing, although well correlated with current infection, is not suitable for immunocompromised populations and during pregnancy, as these populations are immunocompromised and the sensitivity of the test is low, resulting in false negatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method
  • Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method
  • Toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The preparation of embodiment 1 recombinant protein MIC-10A

[0049] 1) Artificially synthesize the following primers:

[0050] FW: GATC GGATCC GATTTTTTTAACGATTAC

[0051] RV: GATC AAGCTT TCATTCACGAAGTCCTCTTTTC

[0052] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6min. , to obtain the MIC-10A gene fragment, see attached figure 1 , cloned into the PMD-18T vector, identified by enzyme digestion, see the attached figure 2 , the nucleotide sequence of which is shown in SEQ ID No.1;

[0053] 3) Insert the MIC10A gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10A;

[0054] 4) Transfer the recombinant expression plasmid PET28A-MIC1...

Embodiment 2

[0055] The preparation of embodiment 2 recombinant protein MIC-10B

[0056] 1) Artificially synthesize the following primers:

[0057] FW: GATCGGATCCGCCGCTGAGCGTGAGGAGAAG

[0058] RV: GATCAAGCTTTCACATTGATTTCCTGCG

[0059] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6 minutes to obtain the MIC-10B gene fragment, see attached figure 1 , cloned into the PMD-18T vector, identified by enzyme digestion, see the attached figure 2 , the nucleotide sequence of which is shown in SEQ ID No.2;

[0060] 3) Insert the MIC10B gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10B; figure 2 ;

[0061] 4) Transfer the recombinant expression plasmid PET28A...

Embodiment 3

[0062] Example 3 Preparation of recombinant fusion protein MIC-10C

[0063] 1) Artificially synthesize the following primers:

[0064] FW: GATCGGATCCGATTTTTTTAACGATTAC

[0065] RV: GATCAAGCTTTCACATTGATTTCCTGCG

[0066] 2) Extract the genomic DNA of RH strain Toxoplasma gondii as a template and carry out PCR amplification. The amplification conditions are: pre-denaturation at 95°C for 2 minutes, denaturation at 94°C for 50 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, 35 cycles , and finally extended at 72°C for 6 minutes to obtain the MIC10C gene fragment; cloned into the PMD-18T vector, identified by enzyme digestion, and its nucleotide sequence is shown in SEQ ID No.2;

[0067] 3) Insert the MIC10C gene fragment into the expression vector PET28A to construct the recombinant expression plasmid PET28A-MIC-10C;

[0068] 4) Transfer the recombinant expression plasmid PET28A-MIC-10C into BL21(DE3) for expression to obtain the recombinant fusion prote...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a toxoplasma circulating antigen double antibody sandwich ELISA (Enzyme-Linked Immuno Sorbent Assay) detection reagent and a preparation method. Toxoplasma MIC10 is a protein secreted by toxoplasma when invading a host cell and has important actions in invasion and proliferation of the toxoplasma. In the invention, amplification and expression at different areas are carried out on an MIC10 gene to obtain recombinant fusion proteins MIC10A, MIC10B and MIC10C, the purified recombinant fusion proteins MIC10A and MIC10B respectively immunize rabbits, are used for preparinga polyclonal antibody and are respectively used as a coated antibody and a detection antibody, a double antibody sandwich ELISA is established with purified MIC10C as a standard antibody to detect a toxoplasma circulating antigen in serum and has the advantages of strong specificity, strong sensitivity, strong reproducibility and strong stability, wherein y is equal to 0.0304Ln(x)-0.0567, R2 is equal to 0.9643, and the minimum detectable amount is 50pg / ml.

Description

technical field [0001] The invention belongs to the technical field of biological inspection and quarantine. Specifically, a recombinant protein is constructed, and antibodies prepared by immunizing the recombinant protein are used to establish a double-antibody sandwich ELISA detection method for circulating antigens of toxoplasma gondii. Background technique [0002] Toxoplasma gondii (toxoplasma) is an obligate intracellular parasitic protozoan, which has a wide range of host groups and is prevalent worldwide, causing zoonotic parasitic diseases. Toxoplasma gondii, as an opportunistic infection factor, can cause death in patients with impaired or suppressed immune function such as AIDS patients, organ transplantation patients and malignant tumor patients. Toxoplasmosis is not only an important disease in medicine, but more importantly, it is an important biological factor affecting human prenatal and postnatal care. [0003] The human body is infected with Toxoplasma gon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/45C12N15/12C12N15/63C07K16/20C07K16/06G01N33/543
Inventor 向梅尹继刚王海礁陆慧君姜宁陈启军
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com