Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof

A detection method and kit technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., to achieve the effect of solving post-PCR contamination

Inactive Publication Date: 2013-04-24
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] At present, there are few reports at home and abroad that can quickly, simply, specifically and sensitively detect transgenic Xa21 rice or its products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof
  • Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof
  • Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The inventors of the present invention design and detect the Xa21 gene-specific oligonucleotide primer pair and probe for the Xa21 gene transgenic rice or its products for the first time through the rice Xa21 gene sequence.

[0050] The italics are the rice mitochondrial gene sequence, and the underlined part is the Xa21 gene sequence

[0051] CTTTCCTTTGTATACTGAGCCAAATGATCCAGAACC (SEQ ID No. 7)

[0052] Transformation event-specific primer and probe sequences: the base sequence of the upstream primer is SEQ ID No.1, the base sequence of the downstream primer is SEQ ID No.2; the base sequence of the probe is SEQ ID No.3 , a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.

[0053] Intron sequence of Xa21 gene

[0054] TCCTTCCAGTATTTTGCATTTTCTGATCTCTAGTGCTATATGAAATAGTTTTTACCTCTAGTGAAACTGATGGAGAATATAAGTAATTAATTGAACTAATTAAATTGCACAAAAATAAGATTATTTGCCATATCTATTCAGATGCTAAATAGCTAGTTCAT...

Embodiment 2

[0057] This embodiment tests the specificity and sensitivity of the transformation event, wherein the specific primer M12-F / R is used, that is, the base sequences of the oligonucleotide primers used are SEQ ID No.1 and SEQ ID No.2, and the detection The base sequence of the needle is SEQ ID No.3, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.

[0058] The specificity and sensitivity of the transformation event can be tested by detecting the DNA of Kangyou 97 rice with different relative mass fractions.

[0059] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.

[0060] In this example, 10 samples were tested: Kangyou 97, Kefeng 6, Kemodao (KMD1), Bammi, K105, Minghui 63, Peiza 35, Jindao 9618, Wandao 181, C...

Embodiment 3

[0087] This embodiment tests the specificity and sensitivity of the Xa21 specific primer / probe, wherein the specific primer Xa21-F / R is used, that is, the base sequence of the oligonucleotide primer used is SEQ ID No.4 and SEQ ID No .5. The base sequence of the probe is SEQ ID No.6, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.

[0088] By detecting the intron sequence of the line Xa21 gene, the specificity and sensitivity of the transgenic Xa21 gene can be tested.

[0089] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.

[0090] In this example, 10 samples were tested: Kangyou 97, Kefeng 6, Kemodao (KMD1), Bammi, K105, Minghui 63, Peiza 35, Jindao 9618, Wandao 181, Chunyou 59.

[0091] The main detecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an oligonucleotides primer and probe for testing Xa21 gene modified rice or products thereof. The invention also relates to a real-time fluorescent PCR (Polymerase Chain Reaction) testing method of Xa21 gene modified rice or products thereof, in which the specific oligonucleotides primer and the probe are used. The invention also relates to a test kit for testing the Xa21gene modified rice or the products thereof, which comprises the specific oligonucleotides primer and the probe. The invention also relates to the application of the specific oligonucleotides primer and the probe or the test kit to testing the Xa21 gene modified rice or the products thereof. By using the specific oligonucleotides primer, the probe, the test kit and the PCR testing method, the Xa21gene modified rice or the products thereof can be tested simply, quickly, specifically and sensitively.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the present invention relates to oligonucleotide primers, probes and kits for the detection of transgenic Xa21 rice or its products, for measuring the real-time fluorescence of transgenic Xa21 rice or its products The PCR detection method, and the application of the specific oligonucleotide primers and probes or the kit of the present invention in the detection of transgenic Xa21 rice or its products. Background technique [0002] Genetically modified organisms refer to the use of biotechnology to transfer foreign genes to other species to modify their genetic characteristics, so as to obtain the traits and nutritional qualities required by human beings. Foods that are processed from genetically modified organisms or their raw materials are genetically modified foods. Since the first genetically modified food (transgenic tomato) was born in the United States in 1994, genetically modifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11G01N21/64
Inventor 黄文胜邓婷婷韩建勋陈颖金芜军
Owner CHINESE ACAD OF INSPECTION & QUARANTINE