Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof
A detection method and kit technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., to achieve the effect of solving post-PCR contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The inventors of the present invention design and detect the Xa21 gene-specific oligonucleotide primer pair and probe for the Xa21 gene transgenic rice or its products for the first time through the rice Xa21 gene sequence.
[0050] The italics are the rice mitochondrial gene sequence, and the underlined part is the Xa21 gene sequence
[0051] CTTTCCTTTGTATACTGAGCCAAATGATCCAGAACC (SEQ ID No. 7)
[0052] Transformation event-specific primer and probe sequences: the base sequence of the upstream primer is SEQ ID No.1, the base sequence of the downstream primer is SEQ ID No.2; the base sequence of the probe is SEQ ID No.3 , a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.
[0053] Intron sequence of Xa21 gene
[0054] TCCTTCCAGTATTTTGCATTTTCTGATCTCTAGTGCTATATGAAATAGTTTTTACCTCTAGTGAAACTGATGGAGAATATAAGTAATTAATTGAACTAATTAAATTGCACAAAAATAAGATTATTTGCCATATCTATTCAGATGCTAAATAGCTAGTTCAT...
Embodiment 2
[0057] This embodiment tests the specificity and sensitivity of the transformation event, wherein the specific primer M12-F / R is used, that is, the base sequences of the oligonucleotide primers used are SEQ ID No.1 and SEQ ID No.2, and the detection The base sequence of the needle is SEQ ID No.3, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.
[0058] The specificity and sensitivity of the transformation event can be tested by detecting the DNA of Kangyou 97 rice with different relative mass fractions.
[0059] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.
[0060] In this example, 10 samples were tested: Kangyou 97, Kefeng 6, Kemodao (KMD1), Bammi, K105, Minghui 63, Peiza 35, Jindao 9618, Wandao 181, C...
Embodiment 3
[0087] This embodiment tests the specificity and sensitivity of the Xa21 specific primer / probe, wherein the specific primer Xa21-F / R is used, that is, the base sequence of the oligonucleotide primer used is SEQ ID No.4 and SEQ ID No .5. The base sequence of the probe is SEQ ID No.6, a fluorescent quenching group BHQ1 is connected to the 3' end of the probe, and a fluorescent reporter group FAM is connected to the 5' end.
[0088] By detecting the intron sequence of the line Xa21 gene, the specificity and sensitivity of the transgenic Xa21 gene can be tested.
[0089] Using the combination of the primer pair and the probe of the present invention, compared with other primer pairs, the target fragment can still be amplified specifically and sensitively in the case of a very small sample amount.
[0090] In this example, 10 samples were tested: Kangyou 97, Kefeng 6, Kemodao (KMD1), Bammi, K105, Minghui 63, Peiza 35, Jindao 9618, Wandao 181, Chunyou 59.
[0091] The main detecti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 