Method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes
A technology of foot-and-mouth disease virus and transgenic sheep, applied in the field of cell engineering, can solve problems such as low success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1: Production and molecular biological detection of heterozygous transgenic sheep knocked out by somatic cell clone integrin β6 subunit gene
[0051] The production process of somatic cell clone heterozygous transgenic sheep with integrin β6 subunit gene knockout is as follows: figure 1 As shown, the specific process includes the following steps:
[0052] 1. Construction of the first targeting vector for integrin β6 subunit gene knockout
[0053] The construction of the first targeting vector for integrin β6 subunit gene knockout is as follows: figure 2 As shown, the specific method is as follows:
[0054] Using the genomic DNA of sheep fetal fibroblasts as a template, in the primer pL-upper:
[0055] 5’-ATAAGAAT GCGGCCGC GCGAGAACTGAAACGGATG-3' (the underlined base is the recognition site of restriction endonuclease NotI)
[0056] and primer pL-lower:
[0057] 5'ACGC GTC GAC GGGCACTTTGTTAGACTGA-3' (underlined base is the recognition site of restriction...
Embodiment 2
[0095] Example 2: Production and Molecular Biological Detection of Homozygous Transgenic Sheep with Integrin β6 Subunit Gene Knockout by Somatic Cell Cloning
[0096] The production process of homozygous transgenic sheep knocked out by somatic cell cloning of integrin β6 subunit gene is as follows: figure 1 As shown, the specific process includes the following steps:
[0097] 1. Construction of secondary targeting vector for integrin β6 subunit gene knockout
[0098]On the basis of the integrin β6 subunit gene knockout first targeting vector, the reporter gene GFP was used to replace neo to obtain the second targeting vector. The specific method is as follows:
[0099] Using pRui as a template, in the primer Y-pGK1 upper:
[0100] 5'-CGG GGTACC CTCGAGATAACTTCGTATAGCATAC-3' (underlined base is the recognition site of restriction endonuclease KpnI)
[0101] With primer Y-pGK1 lower:
[0102] 5'- TGAACAGCTCCTCGCCCTTGCTCACCAT ATTGGCTGCAGGTCGAAAG-3' (the underlined base is...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 