Method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes

A technology of foot-and-mouth disease virus and transgenic sheep, applied in the field of cell engineering, can solve problems such as low success rate

Inactive Publication Date: 2012-06-13
DAIRY CATTLE RES CENT SHANDONG ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the limitation of in vitro culture and passage of somatic cells is the difficulty of somatic cell gene targeting research and the success rate is low, some breakthroughs have been made in somatic cell gene targeting research in recent years

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes
  • Method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes
  • Method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Production and molecular biological detection of heterozygous transgenic sheep knocked out by somatic cell clone integrin β6 subunit gene

[0051] The production process of somatic cell clone heterozygous transgenic sheep with integrin β6 subunit gene knockout is as follows: figure 1 As shown, the specific process includes the following steps:

[0052] 1. Construction of the first targeting vector for integrin β6 subunit gene knockout

[0053] The construction of the first targeting vector for integrin β6 subunit gene knockout is as follows: figure 2 As shown, the specific method is as follows:

[0054] Using the genomic DNA of sheep fetal fibroblasts as a template, in the primer pL-upper:

[0055] 5’-ATAAGAAT GCGGCCGC GCGAGAACTGAAACGGATG-3' (the underlined base is the recognition site of restriction endonuclease NotI)

[0056] and primer pL-lower:

[0057] 5'ACGC GTC GAC GGGCACTTTGTTAGACTGA-3' (underlined base is the recognition site of restriction...

Embodiment 2

[0095] Example 2: Production and Molecular Biological Detection of Homozygous Transgenic Sheep with Integrin β6 Subunit Gene Knockout by Somatic Cell Cloning

[0096] The production process of homozygous transgenic sheep knocked out by somatic cell cloning of integrin β6 subunit gene is as follows: figure 1 As shown, the specific process includes the following steps:

[0097] 1. Construction of secondary targeting vector for integrin β6 subunit gene knockout

[0098]On the basis of the integrin β6 subunit gene knockout first targeting vector, the reporter gene GFP was used to replace neo to obtain the second targeting vector. The specific method is as follows:

[0099] Using pRui as a template, in the primer Y-pGK1 upper:

[0100] 5'-CGG GGTACC CTCGAGATAACTTCGTATAGCATAC-3' (underlined base is the recognition site of restriction endonuclease KpnI)

[0101] With primer Y-pGK1 lower:

[0102] 5'- TGAACAGCTCCTCGCCCTTGCTCACCAT ATTGGCTGCAGGTCGAAAG-3' (the underlined base is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for acquiring anti-FMD (foot-and-mouth disease) transgenic goats or pigs by knocking out FMD virus receptor integrin beta6 subunit genes, which comprises the following steps: transfecting embryo fibroblasts of goats or pigs with linearized targeting carriers having report-gene-mutated integrin beta6 subunit genes; carrying out homologous recombination to obtain nuclear donor cells with the integrin beta6 subunit genes replaced; introducing nuclear donor nuclei into enucleated oocytes of goats or pigs to acquire reconstructed embryos; implanting the reconstructed embryos into wombs of surrogate goats or pigs to acquire a filial generation which belongs to heterozygote transgenic goats or pigs with the integrin beta6 subunit genes knocked out; and carrying out secondary targeting and somatocyte cloning on the heterozygote transgenic goats or pigs to acquire homozygote transgenic goats or pigs. The transgenic goats or pigs acquired by the method carry out low-expression or non-expression on the FMD virus receptor integrin beta6 subunits, obviously reduce the FMD virus infection rate and have the anti-FMD capability.

Description

technical field [0001] The invention relates to an animal transgenic technology, in particular to a method for obtaining foot-and-mouth disease-resistant transgenic sheep or pigs by knocking out the foot-and-mouth disease virus receptor integrin (Integrin) β6 subunit gene, and belongs to the field of cell engineering. Background technique [0002] Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious infectious disease that occurs in sheep, pigs and other artiodactyls caused by foot-and-mouth disease virus (FMDV). The World Organization for Animal Health ranks it as the first class A severe infectious disease. Once an outbreak occurs, infected animals must be culled and contacted with infected animals, which will not only cause huge direct economic losses, but also seriously endanger the healthy development of animal husbandry and the foreign trade of related products, and have a profound impact on the country's politics and economy. [0003] At present, most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/873A61D19/04A01K67/027
Inventor何洪彬王洪梅武建明刘蓝吕洋杨宏军宋玲玲孙涛高运东侯明海仲跻峰
OwnerDAIRY CATTLE RES CENT SHANDONG ACADEMY OF AGRI SCI