High-stability Recomb Protein A having antibody binding capacity and preparation thereof

A technology of binding ability and recombinant protein, which is applied in the biological field and can solve problems such as protein A instability and affecting use

CN102558316AActive Publication Date: 2012-07-11上海雅心生物技术有限公司
1 Cites 5 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2012-07-11

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to high-stability Recomb Protein A having an antibody binding capacity and preparation thereof. The invention further provides affinity chromatography columns which contain the high-stability Recomb Protein A having an antibody binding capacity. Compared with wide-type Protein A, the high-stability Recomb Protein A having an antibody binding capacity is greatly improved on stability and has a higher antibody binding capacity.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to highly stable recombinant protein A with antibody binding ability and its production. Background technique

[0002] Protein A (Protein A) is derived from Staphylococcus aureus and is a membrane protein on its surface. Protein A has the ability to specifically bind to antibodies. Protein A affinity chromatography columns have become widely used in the field of biotechnology to purify antibodies. They can be separated from ascites, serum and cell culture supernatant or cell extracts And purify various mammalian antibodies of different subtypes or genetically engineered recombinant proteins containing antibody Fc fragments. Protein A can be produced by genetic engineering recombination technology.

[0003] However, protein A currently on the market has instability defects, thereby affecting its use. This field also needs to further optimize protein A and it...

Examples

Embodiment 1

[0090] Embodiment 1, gene sequence and corresponding protein sequence

[0091] The SPA (32-327) gene sequence is as follows (SEQ ID NO: 1, 891bp):

[0092] CCTGCTGCAAATGCTGCGCAACACGATGAAGCTCAACAAAATGCTTTTTATCAAGTTTTAAATATGCCTAACTTAAATGCTGATCGACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAACTTCAACAAAGATCAACAAAGCGCCTTCTATGAAATTTTGAACATGCCTAACTTAAACGAAGCGCAACGCAATGGTTTCATTCAAAGTCTTAAAGACGATCCAAGCCAAAGCACTAACGTTTTAGGTGAAGCTAAAAAATTAAACGAATCTCAAGCACCGAAAGCTGACAACAATTTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTGAACATGCCTAACTTGAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGTCAAAGTGCTAACCTATTGTCAGAAGCTAAAAAGTTAAATGAATCTCAAGCACCGAAAGCGGATAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCACAAGCACCAAAAGCTGACAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATTTTACATTTACCTAACTTAACTGAAGAACAACGTAACGGCTTCATCCAAAGCCTTAAAGACGATCCTTCAGTGAGC...

Embodiment 2

[0143] Cloning and expression identification of embodiment 2, SPA (FL) full-length gene and SPA (32-327) gene

[0144] 1. PCR amplification to obtain truncated SPA (32-327) and full-length SPA (FL)

[0145] Staphylococcus aureus was cultivated, and its genomic DNA was extracted by conventional methods.

[0146] The following amplification primers were designed to amplify the gene encoding the truncated SPA (32-327):

[0147] Forward: CGCCATATGCCTGCTGCAAATGCTGCGC (SEQ ID NO: 7)

[0148] Reverse: CCGCTCGAGTTATTTTGGTGCTTGAGC (SEQ ID NO: 8)

[0149] The following amplification primers were designed to amplify the gene encoding full-length SPA (FL):

[0150] Forward: CGCCATATGTTGAAAAAGAAAAACATTTATTC (SEQ ID NO: 9)

[0151] Reverse: CCGCTCGAGTTATAGTTCGCGACGACG (SEQ ID NO: 10)

[0152] The above primers were used to amplify the full-length SPA (FL) and the truncated SPA (32-327) respectively with the genomic DNA of Staphylococcus aureus as a template. The results of electrophor...

Embodiment 3

[0155] Embodiment 3, expression optimization of SPA (32-327)

[0156] Please provide the specific method for culturing recombinant BL21(DE3) cells: Pick the single clone colony on the transformation plate, inoculate it into 30mL LB culture medium (containing 100μg / mL Amp), and culture it overnight on a shaker at 37°C (10-12h ), transfer it to a secondary bottle with 2% inoculum size, and continue to cultivate. When the bacterial density reached OD600 0.5-0.6, add IPTG at a final concentration of 0.5mmol / L at 37°C and 12°C for induction for 4 hours, collect the bacterial cells by centrifugation at 10,000rpm, discard the supernatant, ultrasonically disrupt the bacterial cells, and centrifuge. The supernatant and precipitate were identified by electrophoresis.

[0157] Based on the above methods, the effects of different temperatures on the expression of SPA(32-327) and the effects of different IPTG concentrations on the expression of SPA(32-327) were investigated.

[0158] The...