Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-stability Recomb Protein A having antibody binding capacity and preparation thereof

A technology of binding ability and recombinant protein, which is applied in the biological field and can solve problems such as protein A instability and affecting use

Active Publication Date: 2012-07-11
上海雅心生物技术有限公司
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, protein A currently on the market has instability defects that affect its use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-stability Recomb Protein A having antibody binding capacity and preparation thereof
  • High-stability Recomb Protein A having antibody binding capacity and preparation thereof
  • High-stability Recomb Protein A having antibody binding capacity and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Embodiment 1, gene sequence and corresponding protein sequence

[0091] The SPA (32-327) gene sequence is as follows (SEQ ID NO: 1, 891bp):

[0092] CCTGCTGCAAATGCTGCGCAACACGATGAAGCTCAACAAAATGCTTTTTATCAAGTTTTAAATATGCCTAACTTAAATGCTGATCGACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAACTTCAACAAAGATCAACAAAGCGCCTTCTATGAAATTTTGAACATGCCTAACTTAAACGAAGCGCAACGCAATGGTTTCATTCAAAGTCTTAAAGACGATCCAAGCCAAAGCACTAACGTTTTAGGTGAAGCTAAAAAATTAAACGAATCTCAAGCACCGAAAGCTGACAACAATTTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTGAACATGCCTAACTTGAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGTCAAAGTGCTAACCTATTGTCAGAAGCTAAAAAGTTAAATGAATCTCAAGCACCGAAAGCGGATAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCACAAGCACCAAAAGCTGACAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATTTTACATTTACCTAACTTAACTGAAGAACAACGTAACGGCTTCATCCAAAGCCTTAAAGACGATCCTTCAGTGAGC...

Embodiment 2

[0143] Cloning and expression identification of embodiment 2, SPA (FL) full-length gene and SPA (32-327) gene

[0144] 1. PCR amplification to obtain truncated SPA (32-327) and full-length SPA (FL)

[0145] Staphylococcus aureus was cultivated, and its genomic DNA was extracted by conventional methods.

[0146] The following amplification primers were designed to amplify the gene encoding the truncated SPA (32-327):

[0147] Forward: CGCCATATGCCTGCTGCAAATGCTGCGC (SEQ ID NO: 7)

[0148] Reverse: CCGCTCGAGTTATTTTGGTGCTTGAGC (SEQ ID NO: 8)

[0149] The following amplification primers were designed to amplify the gene encoding full-length SPA (FL):

[0150] Forward: CGCCATATGTTGAAAAAGAAAAACATTTATTC (SEQ ID NO: 9)

[0151] Reverse: CCGCTCGAGTTATAGTTCGCGACGACG (SEQ ID NO: 10)

[0152] The above primers were used to amplify the full-length SPA (FL) and the truncated SPA (32-327) respectively with the genomic DNA of Staphylococcus aureus as a template. The results of electrophor...

Embodiment 3

[0155] Embodiment 3, expression optimization of SPA (32-327)

[0156] Please provide the specific method for culturing recombinant BL21(DE3) cells: Pick the single clone colony on the transformation plate, inoculate it into 30mL LB culture medium (containing 100μg / mL Amp), and culture it overnight on a shaker at 37°C (10-12h ), transfer it to a secondary bottle with 2% inoculum size, and continue to cultivate. When the bacterial density reached OD600 0.5-0.6, add IPTG at a final concentration of 0.5mmol / L at 37°C and 12°C for induction for 4 hours, collect the bacterial cells by centrifugation at 10,000rpm, discard the supernatant, ultrasonically disrupt the bacterial cells, and centrifuge. The supernatant and precipitate were identified by electrophoresis.

[0157] Based on the above methods, the effects of different temperatures on the expression of SPA(32-327) and the effects of different IPTG concentrations on the expression of SPA(32-327) were investigated.

[0158] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to high-stability Recomb Protein A having an antibody binding capacity and preparation thereof. The invention further provides affinity chromatography columns which contain the high-stability Recomb Protein A having an antibody binding capacity. Compared with wide-type Protein A, the high-stability Recomb Protein A having an antibody binding capacity is greatly improved on stability and has a higher antibody binding capacity.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to highly stable recombinant protein A with antibody binding ability and its production. Background technique [0002] Protein A (Protein A) is derived from Staphylococcus aureus and is a membrane protein on its surface. Protein A has the ability to specifically bind to antibodies. Protein A affinity chromatography columns have become widely used in the field of biotechnology to purify antibodies. They can be separated from ascites, serum and cell culture supernatant or cell extracts And purify various mammalian antibodies of different subtypes or genetically engineered recombinant proteins containing antibody Fc fragments. Protein A can be produced by genetic engineering recombination technology. [0003] However, protein A currently on the market has instability defects, thereby affecting its use. This field also needs to further optimize protein A and it...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/31C12N15/31C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12P21/02C07K1/14C12R1/19
Inventor 李素霞赵致冯矗
Owner 上海雅心生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com