Method and kit for detecting drug resistance of mycobacterium tuberculosis

A Mycobacterium tuberculosis, drug resistance technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high cost of LiPA, wrong nucleotides, inability to obtain drug resistance information, etc., to improve sensitivity and Effect of Amplification Efficiency

Active Publication Date: 2013-09-11
CAPITALBIO CORP +2
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] (1) DNA sequencing method (DNA sequencing) directly sequences the PCR product of the drug-resistant gene fragment, and then compares it with the same DNA fragment of the standard sensitive strain to analyze the position and distribution of the base mutation, but this method is cumbersome, and the Most of the equipment that needs to be concentrated in some large sequencing companies is difficult to popularize
[0010] (2) PCR-SSCP method PCR-SSCP, that is, polymerase chain reaction-single-strand conformational polymorphism (polymerasechain reaction-singlestranded conforma-tional polymorphism, PCR-SSCP), but this method detects DNA fragments with single base changes The length should be less than 200bp, and relatively complete drug resistance information cannot be obtained from small fragments, and the sensitivity decreases with the increase of DNA length
This method has high specificity, but can only analyze gene mutations at specific sites in known sequences
[0012] (4) Line probe assay (LiPA) LiPA is expensive and difficult to popularize
[0013] (5) Although gene chip technology has made great progress, there are still defects, such as the possibility of wrong nucleotides being mixed in when synthesizing probes
In addition, its operation process is complicated and the required materials are expensive, which hinders the promotion of this technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting drug resistance of mycobacterium tuberculosis
  • Method and kit for detecting drug resistance of mycobacterium tuberculosis
  • Method and kit for detecting drug resistance of mycobacterium tuberculosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1, Primers and Probes for Detecting Mycobacterium tuberculosis drug-resistant gene mutations

[0063] 1. Design and synthesis of primers

[0064] In order to specifically and efficiently amplify the target gene in the nucleic acid sample to be tested, the whole genome DNA (BX842578) sequence of Mycobacterium tuberculosis (MTB) was retrieved from GenBank, and the 759807-763325th nucleoside of rpoB (NC_000962 acid), katG (NC_000962 2153889-2156111 nucleotides), inhA (NC_000962 1674202-1675011 nucleotides) gene polymorphism sites, according to the general principle of primer design, using Primer Premier5.0 and Oligo6 .0 software designed and synthesized the forward and reverse primers used in real-time fluorescent PCR.

[0065] Primer set 1:

[0066] rpoB_comF2: 5'AGCCGATGACCACCCAGGAC 3' (sequence 1)

[0067] 533_R3: 5'AGACCGCCGAGCCCCG 3' (sequence 2)

[0068] 531_Ri2: 5'CCGAGCCCCAGCGCCA 3' (sequence 3)

[0069] 526_R3: 5'CGGCAGTCGGCGCTTGTC 3' (sequence 4)

...

Embodiment 2

[0083] Embodiment 2, the condition exploration of real-time fluorescent PCR

[0084] 1. Template preparation

[0085] According to the 759807-763325 nucleotides of NC_000962, the 1674202-1675011 nucleotides of NC_000962, and the 2153889-2156111 nucleotides of NC_000962, the rpoB gene, inhA gene and katG gene were artificially synthesized respectively, and the artificially synthesized rpoB gene was sequenced The nucleotide sequences of the , inhA gene and katG gene are respectively consistent with the 759807-763325 nucleotides of NC_000962, the 1674202-1675011 nucleotides of NC_000962, and the 2153889-2156111 nucleotides of NC_000962.

[0086] The artificially synthesized rpoB gene, inhA gene, and katG gene were respectively connected to pGEM-T Easy Vector (Promega Company, catalog number: A1380) to obtain wild-type plasmid rpoB, wild-type plasmid inhA, and wild-type plasmid katG, respectively.

[0087] Sequenced:

[0088] The wild-type plasmid rpoB is a plasmid obtained by lin...

Embodiment 3

[0117] Embodiment 3, detect the drug resistance of Mycobacterium tuberculosis in the sample

[0118] 1. Real-time fluorescent quantitative PCR detection of different biological samples

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for detecting drug resistance of mycobacterium tuberculosis. The invention provides special-purpose primers and special-purpose probes for identification of drug resistance of mycobacterium tuberculosis in a sample needing to be detected, wherein the special-purpose primers comprise multiple primer groups; each one of the primer groups comprises a common primer and multiple specific primers for amplification of alleles corresponding to all mutational sites of same-purpose genes; the special-purpose probes comprise multiple types of probes; and each one of the probes specifically binds with target sequences corresponding to the common primer and the specific primers of the primer group. Experiments of the invention prove that the special-purpose primers and the special-purpose probes can be combined by an efficient and sensitive duplex Taqman real-time fluorescent polymerase chain reaction (PCR) technology and a sequence specific primer (SSP) amplification technology so that drug resistance of mycobacterium tuberculosis in a detected sample can be detected in a short time.

Description

technical field [0001] The invention relates to a method and a kit for detecting drug resistance of mycobacterium tuberculosis. Background technique [0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (MTB). According to the data provided by the World Health Organization (WHO), the situation of tuberculosis in the world in 2002 was: about 3 billion infected people and 8.8 million new tuberculosis cases. Among them, there were 3.9 million new smear-positive tuberculosis cases, an increase of 1.1% compared with 2001, and 3.2% of new cases were multi-drug resistant, and the death toll of tuberculosis reached 1.8 million. Retrospective survey results show that the total drug resistance rate of MTB in China is 27.8%, the initial drug resistance rate and acquired drug resistance rate are 18.6% and 46.5%, respectively, and the multidrug resistance rate is 10.7%, of which initial and acquired multidrug resistance The rates were 7.6% and 17.1%, respe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
Inventor王思贤李洪敏高华方魏运荣
OwnerCAPITALBIO CORP