Tobacco curly shoot virus satellite promoter
A promoter and virus technology, applied in the field of tobacco curly virus satellite promoter, can solve the problems of complex transcription process, alpha satellite promoter research that has not been seen yet, achieve broad application prospects, avoid gene silencing phenomenon, and reduce adverse effects Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Cloning and Sequencing of the Rep ORF Promoter Fragment of Tobacco Curly Virus Alpha Satellite
[0054] Molecular techniques were performed essentially as described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY, 1989). Tobacco plants infected with tobacco stem curl virus were used as materials, and the total plant DNA was extracted by CTAB method [Stewart et al., BioTechniques, 1993, 14:748-749]. See the pre-amplified promoter fragments figure 1 . Using the total plant DNA as a template, each promoter fragment of the Rep ORF of the alpha satellite of the tobacco curved stem virus was amplified by specific primers. Primers pRep383F (5'GGAATTCAAGCTTAAAGAAGGA ATGAAATG 3', corresponding to positions 1-17 in SEQ ID NO: 1, introducing EcoR I and Hind III sites) and pRep420R (5'CGAGCTCGGATCCTTCTGTGAAGAAGAGAGAG 3', corresponding to SEQ ID NO: 1 383-365 positions in , Sac I and BamH...
Embodiment 2
[0055] Example 2 Construction of promoter expression vector
[0056] The binary expression vector pINT121 was digested with restriction enzymes Hind III / BamH I (for the construction of the vector, see the paper published by Liu et al., Planta, 2003, 216:824-833). Insert the digested promoter fragment into the corresponding isoenzyme site to construct a promoter expression vector ( figure 2 ): The construct for promoter 420Δ37 is pINT-RepΔ37, the construct for promoter 420Δ127 is pINT-RepΔ127, the construct for promoter 420Δ193 is pINT-RepΔ193, and the construct for promoter 420Δ205 is pINT-RepΔ205.
[0057] The binary expression vector pCHF3-GFP was digested with restriction enzymes EcoR I / Sac I (for the construction of the vector, see the paper published by Xiong et al., namely, Journal of Virology, 2008, 82:12304-12311). Insert the digested promoter fragment into the corresponding isoenzyme site to construct a promoter expression vector ( image 3 ): The construct for promo...
Embodiment 3
[0059] Example 3 Agrobacterium Transformation
[0060] Introduce each promoter construct into the Agrobacterium host cell by electric shock method: refer to the literature [Mattanovich et al., Nucleic Acids Research, 1989, 17:6747], the specific method is as follows: Cultivate Agrobacterium tumefaciens at 28°C and 200rpm for 16h Take 1.5mL bacterial liquid in a 1.5mL centrifuge tube, centrifuge at 8000rpm for 30s, remove the residual liquid, and wash the precipitate with 1mL ddH 2 O was fully suspended, then centrifuged at 8000rpm for 30s, and the above steps were repeated 3 times. After the residue was removed, the pellet was washed with 200 μL ddH 2 Suspension in O means the Agrobacterium is competent for electric shock. Take 200ng of the recombinant plasmid to 200μL competent, mix gently, then transfer to the electric shock cup, put on ice. Install the electric shock device, the voltage is 2500V, press and hold the electric shock button until the electric shock is comple...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


