Check patentability & draft patents in minutes with Patsnap Eureka AI!

Tobacco curly shoot virus satellite promoter

A promoter and virus technology, applied in the field of tobacco curly virus satellite promoter, can solve the problems of complex transcription process, alpha satellite promoter research that has not been seen yet, achieve broad application prospects, avoid gene silencing phenomenon, and reduce adverse effects Effect

Inactive Publication Date: 2012-08-15
ZHEJIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Geminivirus genome structure is relatively simple, but its transcription process is very complex, and the activity and expression types of promoters vary greatly among different geminiviruses, so it has potential application value for the expression of foreign genes
At present, most of the studies on geminivirus promoters at home and abroad are aimed at its helper virus components, and there are only three reports on the beta satellite promoter, and so far there has been no report on the study of the alpha satellite promoter.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco curly shoot virus satellite promoter
  • Tobacco curly shoot virus satellite promoter
  • Tobacco curly shoot virus satellite promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Cloning and Sequencing of the Rep ORF Promoter Fragment of Tobacco Curly Virus Alpha Satellite

[0054] Molecular techniques were performed essentially as described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY, 1989). Tobacco plants infected with tobacco stem curl virus were used as materials, and the total plant DNA was extracted by CTAB method [Stewart et al., BioTechniques, 1993, 14:748-749]. See the pre-amplified promoter fragments figure 1 . Using the total plant DNA as a template, each promoter fragment of the Rep ORF of the alpha satellite of the tobacco curved stem virus was amplified by specific primers. Primers pRep383F (5'GGAATTCAAGCTTAAAGAAGGA ATGAAATG 3', corresponding to positions 1-17 in SEQ ID NO: 1, introducing EcoR I and Hind III sites) and pRep420R (5'CGAGCTCGGATCCTTCTGTGAAGAAGAGAGAG 3', corresponding to SEQ ID NO: 1 383-365 positions in , Sac I and BamH...

Embodiment 2

[0055] Example 2 Construction of promoter expression vector

[0056] The binary expression vector pINT121 was digested with restriction enzymes Hind III / BamH I (for the construction of the vector, see the paper published by Liu et al., Planta, 2003, 216:824-833). Insert the digested promoter fragment into the corresponding isoenzyme site to construct a promoter expression vector ( figure 2 ): The construct for promoter 420Δ37 is pINT-RepΔ37, the construct for promoter 420Δ127 is pINT-RepΔ127, the construct for promoter 420Δ193 is pINT-RepΔ193, and the construct for promoter 420Δ205 is pINT-RepΔ205.

[0057] The binary expression vector pCHF3-GFP was digested with restriction enzymes EcoR I / Sac I (for the construction of the vector, see the paper published by Xiong et al., namely, Journal of Virology, 2008, 82:12304-12311). Insert the digested promoter fragment into the corresponding isoenzyme site to construct a promoter expression vector ( image 3 ): The construct for promo...

Embodiment 3

[0059] Example 3 Agrobacterium Transformation

[0060] Introduce each promoter construct into the Agrobacterium host cell by electric shock method: refer to the literature [Mattanovich et al., Nucleic Acids Research, 1989, 17:6747], the specific method is as follows: Cultivate Agrobacterium tumefaciens at 28°C and 200rpm for 16h Take 1.5mL bacterial liquid in a 1.5mL centrifuge tube, centrifuge at 8000rpm for 30s, remove the residual liquid, and wash the precipitate with 1mL ddH 2 O was fully suspended, then centrifuged at 8000rpm for 30s, and the above steps were repeated 3 times. After the residue was removed, the pellet was washed with 200 μL ddH 2 Suspension in O means the Agrobacterium is competent for electric shock. Take 200ng of the recombinant plasmid to 200μL competent, mix gently, then transfer to the electric shock cup, put on ice. Install the electric shock device, the voltage is 2500V, press and hold the electric shock button until the electric shock is comple...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco curly shoot virus satellite promoter. The promoter comes from an alpha satellite molecule accompanying with the tobacco curly shoot virus. The separated promoter is an upstream noncoding region sequence of a RepORF of the alpha satellite molecule. The invention relates to a promoter sequence of the RepORF of the alpha satellite molecule accompanying with the tobacco curly shoot virus and an expression cassette of the RepORF promoter sequence. The promoter disclosed by the invention can be applied to plant anti-virus gene engineering and plant transgenic engineering.

Description

technical field [0001] The invention relates to a satellite promoter of tobacco curly stem virus. Specifically, the present invention relates to the isolation and identification of the Rep ORF promoter of the alpha satellite molecule of tobacco curly stem virus. The present invention also relates to the construction of a vector cassette containing the Rep ORF promoter of the alpha satellite of Tobacco Curly Virus linked to a heterologous gene. In addition, the present invention also relates to a method for transient expression using expression vectors containing various promoters of the Rep ORF of the alpha satellite of tobacco curl virus. Background technique [0002] The purpose of plant genetic engineering is to introduce foreign genes into recipient plants and make them express correctly and effectively. A suitable promoter is the key factor for the effective expression of foreign genes. The study of promoters is of great significance for us to understand the growth a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82
Inventor 钱亚娟张洁周雪平吴建祥
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More