Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive test kit of susceptibility gene of lung squamous carcinoma

A technology for detecting kits and susceptibility genes, which is applied in the field of molecular biology, and can solve problems such as improvement, reduced ability to destroy, and decreased genome stability

Inactive Publication Date: 2012-09-26
解码(上海)生物医药科技有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When Lys→Gln at position 751 of the XPD gene, the ability to repair DNA damage is reduced, the stability of the genome is reduced, and the ability to resist the damage of carcinogens or other external factors is reduced, which increases the risk of cancer
[0004] Molecular biology studies have shown that individuals carrying GSTT1 deletions have lost the entire gene and lost their functions, which is equivalent to increasing the concentration of environmental toxins and carcinogens, increasing the risk of individuals suffering from a series of types of cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive test kit of susceptibility gene of lung squamous carcinoma
  • Noninvasive test kit of susceptibility gene of lung squamous carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1. Use of detection kits

[0020] 1. Extract DNA template

[0021] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0022] 2. PCR amplification reaction

[0023] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0024] (1) XPD (Lys751Gln) forward primer: 5'TCCTGCGATTAAAGGCTGTG3'

[0025] XPD (Lys751Gln) reverse primer: 5'TACGGACATCTCCCAAATTCATTC3'

[0026] (2) GSTT1 (Null / Present) forward primer: 5′TTCCTTACTGGTCCTCACATCTC3′

[0027] GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'

[0028] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;

[0029] The reaction conditions are: denaturation and enzyme activation at 94°C for 4 m...

Embodiment 2

[0042] Example 2. The service of genetic non-invasive detection for the prevention of squamous cell carcinoma of the lung

[0043] 1. Sampling and DNA extraction

[0044] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0045] 2. Genotype detection

[0046] Use kit provided by the present invention, Lys751Gln on the XPD gene of examinee's genomic DNA, 2 single nucleotide polymorphic sites of GSTT1 gene deletion (Present / Null) carry out DNA sequencing respectively, determine these 2 Genotypes of SNPs loci.

[0047] 3. Risk assessment of high-risk groups for squamous cell carcinoma of the lung

[0048] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of lung squamous cell carcinoma susceptibility genes is issued. The report details the genetic detection informati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive test kit of a susceptibility gene of lung squamous carcinoma. The kit comprises a specific primer of two single nucleotide polymorphism locus gene types for detecting whether Lys75Gln and GSTT1 genes on an XPD (Xeroderma Pigmentosum group D) gene are lacked or not (Present / Null), a DNA (Deoxyribonucleic Acid) sequencing primer, a PCR reaction assembly, a PCR product purifying assembly, a DNA sequencing reaction assembly and the like. The kit is used for estimating a risk grade for a subject suffering the lung squamous carcinoma through detecting the gene types of the two single nucleotide polymorphism loca which are relative to the lung squamous carcinoma; and the subject is guided to prevent the happening of the lung squamous carcinoma in a targeted manner from a gene level according to a gene detection result of each subject, so as to reduce the morbidity of the subject. A sampling method of the invention is as follows: an oral mucosa cell is sampled, the purposes of being painless and noninvasive and avoiding crossed infection can be realized. A sequencing detection result is accurate and reliable, a special imported instrument with expensive cost does not need to be purchased, and the method is easy to popularize and spread.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a detection kit for susceptibility genes of lung squamous cell carcinoma. Cancer direction guide. Background technique [0002] Squamous cell carcinoma of the lung, also known as squamous cell carcinoma, including spindle cell carcinoma, is the most common type, accounting for about 40%-50% of primary lung cancers. Squamous cell carcinoma of the lung is more common in elderly men and is closely related to smoking. Treatment of squamous cell carcinoma of the lung Most patients are diagnosed with advanced lung cancer. Cough, coughing and chest pain, weight loss and anemia are the main clinical manifestations of small cell lung cancer. The disease is a polygenic disease. Studies have found that the XPD gene and GSTT1 gene play a role that cannot be ignored in the process of lung squamous cell carcinoma, which provides a scientific ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products