Noninvasive test kit of susceptibility gene of lung squamous carcinoma
A technology for detecting kits and susceptibility genes, which is applied in the field of molecular biology, and can solve problems such as improvement, reduced ability to destroy, and decreased genome stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1. Use of detection kits
[0020] 1. Extract DNA template
[0021] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0022] 2. PCR amplification reaction
[0023] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0024] (1) XPD (Lys751Gln) forward primer: 5'TCCTGCGATTAAAGGCTGTG3'
[0025] XPD (Lys751Gln) reverse primer: 5'TACGGACATCTCCCAAATTCATTC3'
[0026] (2) GSTT1 (Null / Present) forward primer: 5′TTCCTTACTGGTCCTCACATCTC3′
[0027] GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'
[0028] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;
[0029] The reaction conditions are: denaturation and enzyme activation at 94°C for 4 m...
Embodiment 2
[0042] Example 2. The service of genetic non-invasive detection for the prevention of squamous cell carcinoma of the lung
[0043] 1. Sampling and DNA extraction
[0044] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0045] 2. Genotype detection
[0046] Use kit provided by the present invention, Lys751Gln on the XPD gene of examinee's genomic DNA, 2 single nucleotide polymorphic sites of GSTT1 gene deletion (Present / Null) carry out DNA sequencing respectively, determine these 2 Genotypes of SNPs loci.
[0047] 3. Risk assessment of high-risk groups for squamous cell carcinoma of the lung
[0048] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of lung squamous cell carcinoma susceptibility genes is issued. The report details the genetic detection informati...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com