Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptor iRGD-scFv (G250)-CD8-CD28-CD137-CD3zeta and application thereof

A -CD8-CD28-CD137-CD3, chimeric antigen receptor technology, applied in the field of biology and new medicine, can solve the problems of reducing the proliferation and survival ability of T lymphocytes, reducing the treatment effect and the like

Inactive Publication Date: 2012-11-14
郑骏年
View PDF2 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This immune response will reduce the proliferation and survival of CAR-modified T lymphocytes in vivo, thereby reducing its therapeutic effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor iRGD-scFv (G250)-CD8-CD28-CD137-CD3zeta and application thereof
  • Chimeric antigen receptor iRGD-scFv (G250)-CD8-CD28-CD137-CD3zeta and application thereof
  • Chimeric antigen receptor iRGD-scFv (G250)-CD8-CD28-CD137-CD3zeta and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Construction of lentiviral expression vector carrying chimeric antigen receptor iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ.

[0023] (1) Preparation of fusion gene fragment Igkappa-iRGD-scFv (G250)

[0024] P1: 5'- TGCCGCGGCGACAAGGGCCCCGACTGCGACATTGTGATGACCCA iRGD scFv(G250)

[0025] GTTCCA -3'

[0026] P2: 5'- GCCAGCGTGATCATGAGCCGCGGCTGCCGCGGCGACAAGGGCC Ig kappa signal peptide iRGD

[0027] CCGACT -3'

[0028] P3: 5'- TGCAGATCTTCAGCTTCCTGCTGATCAGCGCCAGCGTGATCATGA

[0029] Igkappa signal peptide

[0030] GC -3'

[0031] P4:5'-ATAT CTCGAG CCACC ATGGACTTCCAGGTGCAGATCTTCAGCTTC

[0032] EcoR I Ig kappa signal peptide

[0033] CTGC -3'

[0034] P5: 5'- TGGTCGCGGCGCTGGCGTCGTGGTTGAGGAGACGGTGACTGAG

[0035] CD8hinge scFv(G250)

[0036] GTTCCT -3'

[0037] P6:5'- AGGAACCTCAGTCACCGTCTCTCTCAACCACGACGCCAGCGCCGC

[0038] scFv(G250) CD8hinge

[0039] GACCA -3'

[0040] P7:5'-AATT TCTAGA TCA GCGAGGGGGCAGGGCCTGCATGTG -3'

[0041] Xba I CD3ζ

[004...

Embodiment 2

[0074] Example 2: Preparation of Chimeric Antigen Receptor iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ Modified T Lymphocytes

[0075] (1) Packaging preparation of lentivirus

[0076] The lentiviral expression plasmid pLVX-iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ and the helper plasmids psPAX2 and pMD2.G were extracted with QIAGEN’s plasmid extraction kit (Catalog no.12662). The three plasmids were transfected with lipo2000 transfection reagent (purchased from Invitrogen) at a ratio of 4:3:1. For specific methods, see the instruction manual of lipo2000 transfection reagent. After 48 hours of transfection, the cell culture supernatant containing the virus was aspirated into an EP tube, centrifuged at 2000 g at 4°C for 10 min, transferred the supernatant to a new EP tube, filtered through a 4.5 μm filter and stored at -80°C.

[0077] (2) Preparation of T lymphocytes

[0078] Take 10ml of fresh blood from a healthy person, and use lymphocyte separation medium (purchased from Mediatech) to s...

Embodiment 3

[0083] Example 3: Anti-tumor effect of T lymphocytes modified by chimeric antigen receptor iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ

[0084] (1) Western Blot detection of G250 antigen expression in human renal carcinoma cells Ketr-3 and human embryonic kidney 293 cells

[0085] Take the human kidney cancer Ketr-3 cells and human embryonic kidney 293 cells (HEK293) in the logarithmic growth phase, wash the cells 3 times with PBS, scrape the cells with a cell scraper, collect the cell pellet by centrifugation at 3000rpm at 4°C for 5min, and add 300ul of lysis buffer (20mM Tris-HCl, PH7.9, 150mM NaCl, 10mM KCl, 0.5mM EDTA, 0.5%NP-40, 10%Glycerol, 1.5mM MgCl 2 , 0.5mM PMSF, 2mM DTT, 2.5mM CaCl 2 ), lyse on ice for 10 min, vortex, 2 min / time, 5 times in total, centrifuge at 17,000 g at 4°C for 5 min, and absorb the supernatant. Take an appropriate amount of supernatant, and use the mouse anti-human G250 monoclonal antibody for Western blot detection, with Actin as the internal referen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and new medicines and discloses a chimeric antigen receptor (CAR) iRGD-scFv (G250)-CD8-CD28-CD137-CD3zeta and application thereof. The chimeric antigen receptor is formed by series connection of tumor penetrating peptide iRGD, a single-chain antibody of a humanized anti-human renal carcinoma antigen G250, a hinge region and a transmembrane region of CD8, and intracellular signal structural domains of CD28, CD137 and CD3zeta. The chimeric antigen receptor can be used for modifying T lymphocytes, and the modified T lymphocytes can be used for renal carcinoma treatment.

Description

technical field [0001] The invention belongs to the technical field of biology and new medicine. Specifically, it is the preparation of a chimeric antigen receptor iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ. Its preparation involves the use of molecular biology techniques to encode tumor-penetrating peptide iRGD, a single-chain antibody against human kidney cancer G250 antigen, the transmembrane region and intracellular region of CD8, and the intracellular signaling domains of CD28, CD137, and CD3ζ The nucleotide sequences are connected sequentially to obtain a fusion gene fragment encoding the chimeric antigen receptor iRGD-scFv(G250)-CD8-CD28-CD137-CD3ζ, and a coding sequence of the signal peptide Ig kappa is inserted at its 5' end. The gene fragment is then inserted into a lentiviral expression vector and packaged into a lentivirus. The lentivirus is used to infect human T lymphocytes to make the cells express the chimeric antigen receptor. Such T lymphocytes can recognize the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K38/16A61K47/48A61P35/00
Inventor 郑骏年张青杨洁方琳赵铁锁李连涛李慧忠张宝福程乾章龙珍裴冬生
Owner 郑骏年
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com