Fusion protein capable of targeting activation of RANK signal pathway and recombinant plasmid and application thereof
A signaling pathway and fusion protein technology, which can be applied to fusion proteins that target and activate the RANK signaling pathway and their recombinant plasmids and application fields. Commercial value, the effect of avoiding side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] (1) Preparation of recombinant vector pENTR-2B-Gyrase B-HA
[0037] ① Obtain the Gyrase B gene by PCR reaction, and the primers (both 5'-3', synthesized by BGI) are as follows:
[0038] FP: CGGGATCCACCATGTACCCATACGATGTTCCAGATTACGCTATGTCGAACTCTTATGACTCCTCC
[0039] RP: CGGAATTCTTAGGTACCGCCTTCATAGTGGAAGTGGTCTTC.
[0040] Mix the PCR reaction solution according to the following system:
[0041]
[0042] The PCR reaction was performed according to the following procedures: initial denaturation at 94°C for 2 min; denaturation at 94°C for 15 sec, refolding at 55°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; 72°C for 10 min.
[0043] ② Add 2.5 times the volume of frozen absolute ethanol to the PCR product obtained in step ① (add 0.1 times, 3M sodium acetate at pH 5.6 at the same time) to precipitate, and centrifuge to precipitate. The precipitate is formulated according to the following reaction system:
[0044] PCR precipitate
[0045]
[0046] The above re...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com