Method for identifying new generations breeding prawn varieties

An identification method and a new variety of technology, applied in the field of molecular biology, can solve problems such as single source, achieve the effect of improving accuracy, reducing identification cost, and improving identification accuracy

Active Publication Date: 2013-01-23
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current breeding of prawns is through generations of selection for a certain trait, and its genetic characteristics tend to be uniform, and because the selection is carried out on a certain basic group, the source is relatively single, which is through microsatellites. and mitochondrial control regions provide the possibility of germplasm identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying new generations breeding prawn varieties
  • Method for identifying new generations breeding prawn varieties
  • Method for identifying new generations breeding prawn varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Identification process:

[0070] 1. Randomly select 71 samples of new species of prawns selected and bred through generations, and take 60 representative shrimps of Chia prawns, Tongwei shrimps and Fujian second-generation shrimps that are widely used in the market as control samples, and extract the samples of successive generations. Breeding samples of new species of prawns and DNA of control samples.

[0071] 2. Use the primer pair for amplifying the 14950-15583 segment of the mitochondrial control region of Litopenaeus vannamei to amplify the 71 successive generations of selected shrimp samples obtained above and randomly select 104 control sample DNAs from the control samples;

[0072] CRF: 5'-ACCATTGACCTAAAAGTGAAAGAAC-3'

[0073] CRR: 5'-ATCAATAAATATAAATTAACTACGC-3'

[0074] Amplify the sequence with a length of 634bp, and use CRF and CRR primers for bidirectional sequencing to splice and remove low-quality sequences to obtain the results.

[0075] 3. Then use ...

Embodiment 2

[0089]1. Randomly select 50 new varieties of prawns bred through generations and randomly purchase 51 new varieties of prawns that were not bred through generations from the market. Genomic DNA was extracted using the Tiangen Marine Animal Genome Extraction Kit, and the operation was carried out according to the instructions. The DNA concentration obtained was determined.

[0090] 2. Dilute the extracted genomic DNA to 40ng / μl and use primers to amplify the mitochondrial genome control region

[0091] F:ACCATTGACCTAAAAGTGAAAGAAC

[0092] R: ATCAATAAATATAAATTAACTACGC

[0093] The mitochondrial genome control region sequence was amplified to obtain a 634bp sequence, and the sequence results were obtained after bidirectional sequencing using CRF and CRR primers to remove low-quality sequences, and the multiple sequence alignment results were obtained through the Clustalw program in the Bioedit software, and the results were imported into the DNAsp software Obtain haplotype info...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to molecular biological techniques, specifically to a method for identifying new generations breeding prawn varieties. The method comprises the following steps: amplifying and sequencing a mitochondria control zone of colonies to be identified by using primers in the mitochondria control zone; amplifying the haplotype colonies to be identified and according with generations breeding colonies in the sequenced mitochondria control zone by using five pairs of microsatellite sites and performing microsatellite parting to the amplified products; after that, distinguishing and analyzing according to microsatellite parting data to further obtain new generations breeding prawn varieties. The method identifies through molecular markers so as to overcome the difficulty that phenotypic characteristics identify new generations breeding varieties difficultly, finishes detection when prawn individual is small and is not influenced by development stage and size of the prawn individual so as to improve accuracy for identification; the identifying method can identify the new generations breeding prawn varieties.

Description

technical field [0001] The invention relates to molecular biology techniques, in particular to a method for identifying new varieties of prawns selected and bred through generations. Background technique [0002] Litopenaeus vannamei is currently the prawn with the largest breeding area and the highest yield in my country and the world, accounting for 81% of my country's prawn farming output and 66% of the world's prawn farming output. Good germplasm resources are the prerequisite for the healthy and sustainable development of the Litopenaeus vannamei aquaculture industry. Therefore, the development of artificial breeding of Litopenaeus vannamei has attracted great attention from researchers and enterprises. [0003] Combining family selection and group breeding, the breeding of Litopenaeus vannamei can realize the selection of excellent production traits such as fast growth, strong stress resistance, and high disease resistance, and improve the feed coefficient, growth rate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor相建海于洋张晓军李富花
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI