Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

A gene amplification and mitochondrial technology, which is applied in DNA preparation, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of amplifying mitochondria that have never been reported, and achieve the promotion of development, strong amplification ability, and wide amplification range effect

Active Publication Date: 2014-07-09
ZHEJIANG OCEAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no universal primers have been reported to amplify mitochondrial COⅢ and ND3 gene sequences, especially for gobies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Design and synthesis of primers for amplification of mitochondrial COⅢ and ND3 genes of gobies:

[0029] Log in to the GenBank database on the NCBI website to search for the COⅢ gene and tRNA-Arg gene sequences of the mitochondrial genomes of other species of gobies and related species that have been determined, load the sequences into the analysis software MEGA5.0, and use the ClustalW algorithm to perform Multi-sequence alignment analysis, find the conserved sequence, load the found conserved sequence into Premier Primer5.0 software and design a goby in the manual design mode (that is, select Low under the manual option, and the specific parameters are the default settings). Fish mitochondrial COⅢ and ND3 gene amplification primers: the light chain primer Gobies-COⅢ-ND3-F (shown in SEQ ID No.1) has 21 bases: ATACCACATAGTAGACCCCAG, located on the COⅢ gene; the heavy chain primer Gobies-COⅢ -ND3-R (shown in SEQ ID No.2) has 21 bases: GACTTTAACCACGAGCTTTTG, located on...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of fish mitochondrial genome research, and specifically relates to a COⅢ and ND3 gene amplification primer, which is composed of two single-stranded oligonucleotide chains, wherein the light chain primer is the nucleotide shown in SEQ ID No.1 sequence; the heavy chain primer is the nucleotide sequence shown in SEQ ID No.2. The invention also provides the design and amplification method of the amplification primer. The invention can efficiently and specifically amplify the mitochondrial COⅢ and ND3 gene sequences of various gobies, and can be applied to the evolution and classification research of different taxonomic stages of the gobies.

Description

technical field [0001] The invention belongs to the field of fish mitochondrial genome research, in particular to a method for efficiently amplifying most of the sequences of mitochondrial cytochrome c (Cytc) oxidase subunit III (cytochrome c oxidase subunit III; COⅢ) genes and NADH of various gobies Reductase complex subunit 3 (NADH dehydrogenase subunits 3; ND3) gene sequence amplification primers and its design and amplification method. Background technique [0002] The fish mitochondrial genome consists of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), a total of 37 coding genes and a major non-coding region (control region). It has the characteristics of large number, strict maternal inheritance, almost no recombination, high coding efficiency, fast evolution rate and differences in evolution rate in different regions. Due to these characteristics of the fish mitochondrial genome, it has become an important molecular marker in the researc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/10
Inventor徐田军王日昕金逍逍孙悦娜
OwnerZHEJIANG OCEAN UNIV