Chitosan nanoparticle, biopesticide preparation for controlling pine wood nematode and preparation method thereof

A technology of chitosan nanoparticles and pine xylophilus, which is applied in botany equipment and methods, biocides, nematicides, etc., can solve the problems of unrealized standardization level, small molecular weight, and difficulty in large-scale production, and achieve high Pest control effect, standardization of production steps, effect of improving stability

Active Publication Date: 2016-03-30
GUANGZHOU RIBOBIO
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the above reports have successfully prepared pesticide chitosan nanoparticle preparations, their research and development are still in the exploratory stage, and the physical and chemical indicators such as the size, particle size distribution, and drug loading rate of the prepared nanoparticles are unstable, and the standardization level has not been achieved. It is cumbersome and difficult to achieve large-scale production, so it has been limited to laboratory research so far, and has not been transformed into a product preparation circulation market
In addition, the active ingredients of the pesticide chitosan preparations successfully reported so far are mostly existing chemical pesticides with small molecular weight and relatively simple technical operation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitosan nanoparticle, biopesticide preparation for controlling pine wood nematode and preparation method thereof
  • Chitosan nanoparticle, biopesticide preparation for controlling pine wood nematode and preparation method thereof
  • Chitosan nanoparticle, biopesticide preparation for controlling pine wood nematode and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The present embodiment particularly provides chitosan with pine wood nematode acetylcholinesterase gene double-stranded ribonucleic acid sequence as active ingredient

[0047]

[0048] Preparation of sugar nanoparticle biological preparation and its effect research.

[0049] (1) Design and synthesis of original drug components targeting pine wood nematode acetylcholinesterase gene double-stranded ribonucleic acid

[0050]

[0051] The 3' end of the above sequence is provided with dTdT dangling bases. The double-stranded ribonucleic acid is designed and synthesized according to the above sequence and freeze-dried into the powder of the original medicine.

[0052] (2) Preparation of 0.05% double-stranded ribonucleic acid biopesticide preparation

[0053] 1 Dissolution of active ingredients: Weigh 500mg of the above-mentioned double-stranded ribonucleic acid, dissolve it in 199.5g of water, stir at 800r / min to fully dissolve;

[0054] 2 Preparation of chitosan nan...

Embodiment 2

[0073] This example particularly provides the preparation and effect research of the chitosan nanoparticle biological preparation targeting the double-stranded ribonucleic acid sequence of the calprotectin gene of pine wood nematode as the active ingredient.

[0074] (1) Design and synthesis of active ingredients for double-stranded RNA of pine wood nematode calreticulin gene

[0075] CRT: GU585910

[0076] Si-CRT_001: GACTGTGGAGGTGGATATTTG

[0077] Sense strand (5'-3'): 5'GACUGUGGAGGUGGAUAUUUGdTdT3'SEQ ID NO.19

[0078] Antisense strand (3'-5'): 3'dTdTdTdTCUGACACCCUCCACCUAUAAAC5'SEQ ID NO.20

[0079]Si-CRT_002: GAGATCTACAAGTTCGATGAC

[0080] Sense strand (5'-3'): 5'GAGAUCUACAAGUUCGAUGACdTdT3'SEQ ID NO.21

[0081] Antisense strand (3'-5'): 3'dTdTCUCUAGAUGUUCAAGCUACUG5'SEQ ID NO.22

[0082] Si-CRT_003: TTGAATTATCTTGGAAATGAC

[0083] Sense strand (5'-3'): 5'UUGAAUUAUCUUGGAAAUGACdTdT3'SEQ ID NO.23

[0084] Antisense strand (3'-5'): 3'dTdTAACUUAAUAGAACCUUUACUG5'SEQ ID NO.24...

Embodiment 3

[0106] This example particularly provides the preparation and effect research of the chitosan nanoparticle biological preparation aimed at the double-stranded ribonucleic acid sequence of the electron transfer flavoprotein gene of pine wood nematode as the active ingredient.

[0107] Electron transfer flavoprotein gene: GU130161

[0108] (1) Design and synthesis of double-stranded ribonucleic acid technical drug for pine xylophilus electron transfer flavoprotein gene

[0109] Si-001: ACGAAATTAGTGTGCTGGTG

[0110] Sense strand (5'-3'): 5'ACGAAAUUAGUGUGCUGGUGdTdT3'SEQ ID NO.25

[0111] Antisense strand (3'-5'): 3'dTdTUGCUUUAAUCACACGACCAC5'SEQ ID NO.26

[0112] Si-002: ATCGTCCCGACCTCCAAACC

[0113] Sense strand (5'-3'): 5'AUCGUCCCGACCUCCAAACCdTdT3'SEQ ID NO.27

[0114] Antisense strand (3'-5'): 3'dTdTUAGCAGGGCUGGAGGUUUGG5'SEQ ID NO.28

[0115] The 3' end of the above sequence is provided with dTdT dangling bases. The double-stranded ribonucleic acid is designed and synthesi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a chitosan nanoparticle which is formed by raw materials in percentage by weight: 0.5-5% of chitosan, 1-10% of a cosolvent, 0-5% of an anti-freezing agent, 0.1-1% of a surfactant, 0.1-0.5% of an emulsifying agent, 40-60% of buffering liquid and of the balance of water. The invention further provides a biological pesticide preparation and a preparation method thereof. The biological pesticide preparation is mainly prepared from the following components in percentage by weight: (A) 0.05-15% of an effective component, (B) 19.95-55% of a solvent, and (C) 30-80% of the chitosan nanoparticle, wherein in the effective component, siRNA (small interfering Ribonucleic Acid) is synthesized aiming at pine wood nematode efficient lethal target genes and the siRNA is 15-50nt double-chain RNA. According to the chitosan nanoparticle, the stability of the biological pesticide preparation is better and the effect of preventing and treating pine wood nematodes is better.

Description

technical field [0001] The invention belongs to the technical field of agricultural insecticides, and specifically relates to a biological pesticide preparation and a preparation method thereof, in particular to a chitosan nanoparticle, a biological pesticide preparation containing double-stranded ribonucleic acid for controlling pine wood nematode and a preparation method thereof. technical background [0002] Pine wood nematode [Bursaphelenchus xylophilus (Steiner & Buhrer 1934) Nikle1970, synonym: Aphelenchoides xylophilus Striner & Buhrer Bursaohelenchus lignicol-US Mamiya & Kiyohara] causes pine wilting disease (PineWiltDisease) is a big important disease of forestry production, is known as the cancer of pine. It can harm 57 species of Pinus plants and 14 species of non-pine conifers including Cedrus, Abies, Picea, Larix and Pseudotsuga . Trees usually die within 2-3 months after being infected with pine wood nematode. The vector insect of this pest is mainly monocham...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A01N43/90A01N25/04A01P5/00
Inventor 张必良叶奕栋
Owner GUANGZHOU RIBOBIO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap