Modified cloning vector and application thereof
A cloning vector and vector technology, applied in the field of vectors that facilitate gene cloning work, can solve the problems of double-enzyme-cleavage cloning restriction, troublesome TA cloning, influence, etc., and achieve the effect of reducing work cost, simple cloning operation, and convenient use.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1 vector construction
[0027] Using the pUC57 vector as the modified parent, adjust all restriction sites in the LacZ sequence. Remove all the sites in the multiple cloning site, replace it with the three blunt-end cloning sites of EcoRV SmaI StuI, remove the NdeI restriction site downstream of LacZ, and finally obtain a recombinant plasmid that only EcoRV SmaI StuI can use (hereinafter referred to as vector pUCK) .
[0028] The design idea and technical route of the cloning vector pUCK are as follows:
[0029] 1. LacZ sequence design. The LacZ sequence in the vector pUC57 is SEQ ID NO.2, and the modified LacZ sequence is SEQ ID NO.3. The present invention removes the multiple cloning site upstream of LacZ in pUC57 and replaces it with three blunt-ended cloning sites EcoRV SmaI StuI, and made a synonymous mutation to NdeI at the same time. Ensure that the LacZ gene can be expressed smoothly and perform normal functions.
[0030] LacZ 348bp in SEQ ID NO....
Embodiment 2
[0087] Example 2 Application Comparison 1
[0088] Using pig cDNA as a template, PCR target gene Sus EGF partial fragment 255bp, the sequence of the obtained fragment is SEQ ID NO.4, which is used for protein expression.
[0089] SEQ ID NO.4 Sus EGF partial sequence 255bp
[0090] TCTGTGAGAAATAGTTACTCTGAATGCCCGCCGTCCCACGACGGGTACTGCCTCCACGGTGGTGTGTGTATGTATATTGAAGCCGTCGACAGCTATGCCTGCAACTGTGTTTTTGGCTACGTTGGCGAGCGATGTCAGCACAGAGACTTGAAATGGTGGGAGCTGCGCCACGCTGGCCTCGGGCGACAGTGGAACGTCACGGTGGTGGCCGTCTGCGTGGTGGTGCTGGTCCTGCTGCTGCTCCTGGGGCTGTGG
[0091] Design the following two primers:
[0092] P8TCTGTGAGAAATAGTTACTCTGA (SEQ ID NO. 13)
[0093] P9CCACAGCCCCAGGAGCAGCAGC (SEQ ID NO. 14)
[0094] Using pig cDNA as a template, a 255bp fragment was amplified with upstream primer P8 and downstream primer P9.
[0095] PCR reaction system:
[0096]
[0097] Reaction procedure:
[0098] 1.95°C (pre-denaturation) for 3 minutes;
[0099] 2.94°C (denaturation) 20s
[0100] 3.57℃ (annealing...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 