Method for reconstructing recombinase FLP (flippase) and application of method
A technology of recombinant enzymes and expression elements, applied in the field of molecular biology, can solve problems such as unclear protein activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The resolution of embodiment 1 recombinase FLP
[0039] The study found that the recombinant protein FLP is composed of two domains, namely the binding domain located in the 2-107 interval of the N-terminus, and the active domain located in the 362-423 interval of the C-terminus, and the region outside these two domains is the connecting region. Based on the results of previous studies and the analysis of the secondary and tertiary structures of FLP, the complete recombinase FLP was split between the 150th and 151st amino acids and named FLPn and FLPc, respectively. At the same time, the nuclear localization signal NLS SV40 was also fused to the N-terminus of each split fragment, named nFLPn and nFLPc.
Embodiment 2
[0040] The construction of embodiment 2 plant expression vectors
[0041] 1 Acquisition of FRT-nos-FRT containing FLP recognition site
[0042] In order to construct a pair of recognition sites FRT in the same direction on the vector pCAMBIA1305.1, the present invention uses artificially synthesized fusion fragment FRT-nos-FRT, the sequence is as follows: 5'-CG GGATCC GAAGTTCCCTATACTTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTC AGATCT T CCATGG CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTT GCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTA ACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTAT ACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGC GCGGTGTCATCTATGTTACTAGATCGGGGAAGTTCCTATACTTTCTAGAGAATAGGAAC TTCGGAATAGGAACTTC GGATCC GC-3', the underlines are BamH Ⅰ, Bgl Ⅱ, Nco Ⅰ, and BamH Ⅰ recognition sites, which were excised from the pUC19 vector with BamH Ⅰ and connected to the vector pCAMBIA1305.1 digested with Bgl Ⅱ (see figure 1 ), the obtained positive ...
Embodiment 3
[0077] Embodiment 3 Agrobacterium rhizogenes infects tobacco
[0078] Subculture of tobacco sterile seedlings:
[0079] Cut off the stem section with leaf buds from the sterile tobacco seedlings, inoculate them on the MS subculture medium, cultivate them under light at 25°C, and grow them for 2-3 weeks to subculture the sterile tobacco seedlings, which can be used for genetic transformation.
[0080] Cultivation and activation of Agrobacterium rhizogenes
[0081] Take the Agrobacterium strains stored at -80°C, dip a small amount of bacterial solution with an inoculation loop and streak on the solid medium (YEP+50mg / L Kan (kanamycin)+40mg / L Rif (rifampicin)) After a single colony grows, pick a single colony and shake it at 180rpm at 28°C in 10mL Agrobacterium liquid medium (YEP+50mg / L Kan (kanamycin)+40mg / L Rif (rifampicin)) Cultivate for 16-24 hours. Inoculate 500 μL of a live bacterial solution into 50 mL of the same Agrobacterium liquid medium, and cultivate overnight at ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 