Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for reconstructing recombinase FLP (flippase) and application of method

A technology of recombinant enzymes and expression elements, applied in the field of molecular biology, can solve problems such as unclear protein activity

Inactive Publication Date: 2013-08-28
SOUTHWEST UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the disassembly and reconstruction of recombinant proteins have only been reported in animal cells, and it is not clear whether their protein activity can be restored in plant cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for reconstructing recombinase FLP (flippase) and application of method
  • Method for reconstructing recombinase FLP (flippase) and application of method
  • Method for reconstructing recombinase FLP (flippase) and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The resolution of embodiment 1 recombinase FLP

[0039] The study found that the recombinant protein FLP is composed of two domains, namely the binding domain located in the 2-107 interval of the N-terminus, and the active domain located in the 362-423 interval of the C-terminus, and the region outside these two domains is the connecting region. Based on the results of previous studies and the analysis of the secondary and tertiary structures of FLP, the complete recombinase FLP was split between the 150th and 151st amino acids and named FLPn and FLPc, respectively. At the same time, the nuclear localization signal NLS SV40 was also fused to the N-terminus of each split fragment, named nFLPn and nFLPc.

Embodiment 2

[0040] The construction of embodiment 2 plant expression vectors

[0041] 1 Acquisition of FRT-nos-FRT containing FLP recognition site

[0042] In order to construct a pair of recognition sites FRT in the same direction on the vector pCAMBIA1305.1, the present invention uses artificially synthesized fusion fragment FRT-nos-FRT, the sequence is as follows: 5'-CG GGATCC GAAGTTCCCTATACTTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTC AGATCT T CCATGG CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTT GCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTA ACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTAT ACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGC GCGGTGTCATCTATGTTACTAGATCGGGGAAGTTCCTATACTTTCTAGAGAATAGGAAC TTCGGAATAGGAACTTC GGATCC GC-3', the underlines are BamH Ⅰ, Bgl Ⅱ, Nco Ⅰ, and BamH Ⅰ recognition sites, which were excised from the pUC19 vector with BamH Ⅰ and connected to the vector pCAMBIA1305.1 digested with Bgl Ⅱ (see figure 1 ), the obtained positive ...

Embodiment 3

[0077] Embodiment 3 Agrobacterium rhizogenes infects tobacco

[0078] Subculture of tobacco sterile seedlings:

[0079] Cut off the stem section with leaf buds from the sterile tobacco seedlings, inoculate them on the MS subculture medium, cultivate them under light at 25°C, and grow them for 2-3 weeks to subculture the sterile tobacco seedlings, which can be used for genetic transformation.

[0080] Cultivation and activation of Agrobacterium rhizogenes

[0081] Take the Agrobacterium strains stored at -80°C, dip a small amount of bacterial solution with an inoculation loop and streak on the solid medium (YEP+50mg / L Kan (kanamycin)+40mg / L Rif (rifampicin)) After a single colony grows, pick a single colony and shake it at 180rpm at 28°C in 10mL Agrobacterium liquid medium (YEP+50mg / L Kan (kanamycin)+40mg / L Rif (rifampicin)) Cultivate for 16-24 hours. Inoculate 500 μL of a live bacterial solution into 50 mL of the same Agrobacterium liquid medium, and cultivate overnight at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of the molecular biological technique, and in particularly relates to a method for reconstructing a recombinase FLP (flippase) and application of the method. According to the technical scheme provided by the invention, the method for reconstructing the recombinase FLP comprises the following steps of: a, determining a resolution locus; b, constructing an expression element; and c, transferring to the expression element. The invention also provides application of the method for deleting exogenous genes from genetically modified organisms. The method provided by the invention provides a new choice for safety of the genetically modified organisms.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for transforming the recombinant enzyme FLP and its application. Background technique [0002] Previous studies have shown that some active proteins can be split into inactive peptide chains, and when these peptide chains are expressed in cells at the same time, the activity of the protein can be restored (Shiba K, Schimmel P. (1992) Functional assembly of a randomly cleaved protein. Proc Natl Acad Sci89:1880–1884; Remy I, Michnick SW. (2004) Mapping biochemical networks with protein-fragment complementation assays. Methods Mol Biol 261:411–426). It has been confirmed that the recombinase Cre protein derived from bacteriophage P1 (Bacteriophage P1) can be split into N-terminal α-polypeptide and C-terminal β-polypeptide. In animal cells, 32.5% of the activity of the complete Cre protein was obtained (Casanova et al, (2003) Alpha complementation in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/63C12N15/09
Inventor 罗克明文梦玲高江林汪丽君
Owner SOUTHWEST UNIV