Carbonyl reductase mutant as well as gene and application thereof

A reductase and mutant technology, applied in the field of carbonyl reductase mutants and their genes and applications, can solve the problem of poor thermal stability of carbonyl reductase

Inactive Publication Date: 2014-10-15
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to provide a carbonyl reductase mutant protein with improved thermal stability and a nucleic acid sequence encoding the mutant protein, which contains the nucleic acid Sequential recombinant expression vector and recombinant expression transformant, preparation method of the whole cell for recombinant expression of the carbonyl reductase mutant and its application in catalyzing the asymmetric reduction of carbonyl group and preparation of optically pure chiral alcohol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase mutant as well as gene and application thereof
  • Carbonyl reductase mutant as well as gene and application thereof
  • Carbonyl reductase mutant as well as gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] random mutation

[0054] Using error-prone PCR technology to introduce random nucleotide mutations into the carbonyl reductase gene, the primers used are as follows:

[0055] Upstream primer: ACGCGTCGACAAATGGCTTCTGATAACAGCAAC

[0056] Downstream primer: ATTTGCGGCCGCTTAATTAGAGTTCTTCTCGGC

[0057] Wherein the template is: carbonyl reductase wild enzyme gene recombination plasmid, the gene sequence is as shown in SEQ ID No:1.

[0058] PCR amplification system (50μl): template 0.5~20ng, 5μl 10×rTaq buffer, 5μl dNTP (each 2.0mM), 2μl MgSO 4 (25mM), 5μl MnCl 2 (100 μM), 1 μl of each pair of mutant primers (20 μM), 1 unit of rTaq enzyme (TaKaRa, Japan), add sterilized distilled water to 50 μl.

[0059] PCR amplification program: (1) denaturation at 94°C for 3 minutes; (2) denaturation at 94°C for 10 sec, (3) annealing at 60°C for 30 sec, (4) extension at 68°C for 90 sec, steps (2) to (4) for a total of 30 cycles , and finally extended at 72°C for 10 min, and the product w...

Embodiment 2

[0062] site-directed mutagenesis

[0063] Site-directed mutagenesis using II Site-Directed Mutagenesis Kit (Stratagene, Catalog #200522) protocol for operation. First design the mutation primers containing the mutation point as follows:

[0064] Mutation F92L / F94V:

[0065] Upstream primer: CGCCTTCCCACTACACGTCAACACCACTGA

[0066] Downstream primer: CAGTGGTGTTGACGTGTAGTGGAGAGGCGGTG

[0067] Mutation 199Y:

[0068] Upstream primer: CACCACTGACTACGAAAAGGATCTATTGATCCC

[0069] Downstream primer: GATCCTTTTCATAGTCAGTGGTGTTGAAGTGGAATG

[0070] G174A mutation:

[0071] Upstream primer: TCCAATCAGAGGATACTGTGGTTCAAAGAAGTT

[0072] Downstream primer: CCACAGTAAGCTCTGATTGGATCGGATTGAC

[0073] PCR reaction system (50μl): template 0.5~20ng, 5μl 10×KOD plus buffer, 5μl dNTP (each 2.0mM), 2μl MgSO 4 (25 mM), 1 μl of each pair of mutant primers (20 μM), 1 unit of KOD enzyme (TOYOBO, Japan), and add sterile distilled water to 50 μl.

[0074] PCR amplification program: (1) denaturation ...

Embodiment 3

[0081] Construction of recombinant expression vector (plasmid) and preparation of recombinant expression transformants

[0082] The carbonyl reductase mutant gene DNA fragment obtained in Examples 1 and 2 was double-digested with restriction endonucleases Sal I and Not I at 37°C for 12 h, purified by agarose gel electrophoresis, and purified using agarose gel DNA The recovery kit recovers the target fragment. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET28a that had also been digested by Sal I and Not I, and the recombinant expression plasmid was obtained overnight at 4°C.

[0083] Transform the above-mentioned recombinant expression plasmids into E.coli DH5α competent cells, the transformation condition is heat shock at 45°C for 90 seconds, screen the positive recombinants on the resistance plate containing kanamycin, pick single clones, colonies PCR verified positive clones. Cultivate the recombinant bacteria, extract the plasmid a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a carbonyl reductase CgKR1 mutant, a coding gene of the mutant, a recombinant expression vector containing the gene of the carbonyl reductase mutant, a recombinant expression transformant, a recombinase, a preparation method of the recombinase, and an application of the carbonyl reductase mutant to asymmetric reduction of ketonic ester for preparation of optically pure chiral hydroxyl ester, such as catalysis of o-cyano methyl phenylglyoxylate for asymmetric reduction to prepare (R)-o-chloro mandelic acid methyl ester. Compared with wild enzymes, the carbonyl reductase mutant has the advantages that the thermal stability is substantially improved, and the catalytic activity of part of the mutant to the o-chlorobenzoic acid formyl methyl ester is also obviously improved. The multiple mutants can be applied to catalysis of the ketonic ester for asymmetric reduction to prepare the optical purely-chiral hydroxyl ester, such as catalysis of the o-cyano methyl phenylglyoxylate for asymmetric reduction to prepare the optically pure (R)-o-chloro mandelic acid methyl ester. The carbonyl reductase mutants have the very good industrial application prospect.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a carbonyl reductase CgKR1 mutant and its coding gene, a recombinant expression vector and a recombinant expression transformant containing the carbonyl reductase mutant gene, its recombinase and a preparation method of the recombinase , and the application of the carbonyl reductase mutant in the asymmetric reduction of ketoesters to prepare optically pure chiral hydroxyl esters, such as catalyzing the asymmetric reduction of methyl o-chlorobenzoylformate to prepare (R)-methyl o-chloromandelate . Background technique [0002] Chiral alcohols are widely used in the preparation of chiral medicines, pesticides and various types of chiral materials. Wherein (R)-o-chloromandelic acid methyl ester [(R)-CMM] (molecular formula is o-Cl-C 6 h 4 CH(OH)COOCH 3 , CAS No.: 32345-59-8) is an important chiral intermediate for the synthesis of the platelet aggregation inhib...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12N1/21C12P7/22C12P7/62
CPCC12N9/0006C12P7/62C12Y101/01184
Inventor郁惠蕾黄磊许建和李春秀潘江
OwnerEAST CHINA UNIV OF SCI & TECH