Supercharge Your Innovation With Domain-Expert AI Agents!

Application of mi-RNA (micro-ribonucleic acid) with AAAGUGC seed sequence in preparing interleukin 8 inhibitor

A technology of interleukin and inhibitor, applied in the field of microRNA

Inactive Publication Date: 2014-03-26
DALIAN MEDICAL UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] At present, although there are many research reports on microRNAs (including microRNAs with AAAGUGC seed sequence), so far there is no relevant report on the application of microRNAs with AAAGUGC seed sequence in the preparation of interleukin-8 inhibitors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. IL8 is a direct target gene of miR-17

[0023]First, the present invention analyzed possible microRNA binding sites on the IL8 mRNA 3' UTR through the online microRNA target gene analysis software, and found that the IL8 mRNA 3' UTR only contains one miR-17 binding site, which is located at 593 -600, and this binding site is widely conserved in vertebrates. Then, the 3'UTR reporter gene vector of IL8 containing the miR-17 binding site and the 3'UTR reporter gene vector of the mutated binding site were constructed. The specific experimental method is as follows:

[0024] a. Using the genomic DNA of NB4 cells as a template, a 960-bp truncated IL8 mRNA 3' was amplified using IL8-3' UTR-F / R (see sequence below) specific primers for IL8 mRNA 3' UTR UTR, which contains the binding site for miR-17. The primer sequences for amplifying IL8 mRNA 3' UTR are as follows:

[0025] IL8-3' UTR-F: TATTGTGTGGGTCTGTTGTA (SEQ ID NO. 6)

[0026] IL8-3'UTR-R: TATTGACTGTGGAGTTTTGG (S...

Embodiment 2

[0058] 1. IL8 is a direct target gene of miR-20a

[0059] First, the present invention analyzes possible microRNA binding sites on the IL8 mRNA 3'UTR through the online microRNA target gene analysis software. The results showed that only one miR-20a binding site was contained in IL8 mRNA 3' UTR, located at 593-600, and this binding site was widely conserved in vertebrates. Then, the reporter gene vector of the 3'UTR of IL8 containing the miR-20a binding site and the reporter gene vector of the 3'UTR of the above-mentioned binding site were constructed. The specific experimental method is as follows:

[0060] a. Using the genomic DNA of NB4 cells as a template, a 960-bp truncated IL8 mRNA 3'UTR containing miR was amplified using specific primers IL8-3'UTR-F / R (see sequence below) Binding site for -20a. Primer sequences for amplifying the 3' UTR of the IL8 gene:

[0061] IL8-3' UTR-F: TATTGTGTGGGTCTGTTGTA (SEQ ID NO. 6)

[0062] IL8-3'UTR-R: TATTGACTGTGGAGTTTTGG (SEQ ID NO...

Embodiment 3

[0095] 1. IL8 is the direct target gene of miR-106a

[0096] First, the present invention analyzes possible microRNA binding sites on the IL8 mRNA 3'UTR through the online microRNA target gene analysis software. The results showed that only one miR-106a binding site was contained in IL8 mRNA 3' UTR, located at 593-600, and this binding site was widely conserved in vertebrates. Then, the reporter gene vector of the 3'UTR of IL8 containing the miR-106a binding site and the reporter gene vector of the 3'UTR with the above binding site mutated were constructed. The specific experimental method is as follows:

[0097] a. Using the genomic DNA of NB4 cells as a template, a 960-bp truncated IL8 mRNA 3'UTR containing miR was amplified using specific primers IL8-3'UTR-F / R (see sequence below) Binding site for -106a. Primer sequences for amplifying IL8 mRNA 3'UTR:

[0098] IL8-3' UTR-F: TATTGTGTGGGTCTGTTGTA (SEQ ID NO. 6)

[0099] IL8-3'UTR-R: TATTGACTGTGGAGTTTTGG (SEQ ID NO.7), th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of mi-RNA (micro-ribonucleic acid) with an AAAGUGC seed sequence in preparing an IL8 (interleukin 8) inhibitor. The mi-RNA with the AAAGUGC seed sequence can directly target the 3' non-coding region of the mRNA of IL8, so that secretion of IL8 can be effectively inhibited, and generation of cell endogenic IL8 can be reduced. Therefore, the mi-RNA with the AAAGUGC seed sequence can be used as a cell endogenic IL8 generation inhibitor and used for preventing or treating various diseases or disease states caused by IL8 generation or increase.

Description

technical field [0001] The present invention relates to a new application of microRNA with AAAGUGC seed sequence, especially the application of microRNA with AAAGUGC seed sequence in preparing interleukin-8 inhibitor. Background technique [0002] Infiltration and metastasis are the main biological characteristics of malignant tumors and the main causes of death in cancer patients. In 1971, Folkman et al. found that tumor angiogenesis is the key to rapid tumor growth, invasion and metastasis, and it delivers oxygen and other nutrients needed by tumor cells. Current studies suggest that there are many molecules related to tumor angiogenesis, including vascular endothelial growth factor (VEGF), fibroblast growth factors (FGFs), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), transforming growth factor β ( TGFβ), interleukin 8 (interleukin 8, IL8), etc. Among them, VEGF and its receptors have become a hot topic in tumor research and an important target of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P29/00A61P31/00A61P9/10A61P11/00A61P11/06A61P19/02A61P35/00
Inventor 李传刚李墨林
Owner DALIAN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More