Saddletail grouper antimicrobial peptide LEAP-2 gene, vector, recombinant strain and protein, and application thereof
A LEAP-2, grouper antimicrobial peptide technology, applied in the field of genetic engineering, can solve the problems of high morbidity and mortality, achieve strong antibacterial ability, high economic value, and reduce production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0051] 1. Obtaining the Middle Fragment of the Antimicrobial Peptide LEAP-2 Gene of Scutellaria chinensis by Designing Degenerate Primers
[0052] First search the antimicrobial peptide LEAP-2 gene sequences of zebrafish, large yellow croaker, tilapia, flounder and rainbow trout on NCBI (http: / / www.ncbi.nlm.nih.gov / ) (serial numbers: NM_001128777 .1, JN991058.1, XM_003457723.1, EU586111.1, AY362186.1), and then use ClustalX 2.0 for sequence alignment. Degenerate primers were designed according to the comparison results, in which the upstream primer LEAP-2-S was [5'- TTCACCCAAAGGAAAGCAGC] (SEQ ID NO.6), and the downstream primer LEAP-2-A was [5'-GTCCCGTGGAGCATTCGTAG] (SEQ ID NO. .7). Finally, the antimicrobial peptide LEAP-2 of the grouper was amplified using the PCR Mix of Guangzhou Dongsheng Biotechnology Co., Ltd. and the liver cDNA of the grouper obtained by reverse transcription of the M-MLV reverse transcriptase kit (Invitrogen, USA) as a template. The middle fragment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 