Antimicrobial peptide leap-2 gene, vector, recombinant strain and protein of oblique-banded grouper and its application
A technology of LEAP-2 and grouper antimicrobial peptide, which is applied in the field of genetic engineering, can solve the problems of high morbidity and mortality, achieve strong antibacterial ability, high economic value, and enrich the gene pool
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0050] 1. Obtaining the Middle Fragment of the Antimicrobial Peptide LEAP-2 Gene of Scutellaria chinensis by Designing Degenerate Primers
[0051] First search the antimicrobial peptide LEAP-2 gene sequences of zebrafish, large yellow croaker, tilapia, flounder and rainbow trout on NCBI (http: / / www.ncbi.nlm.nih.gov / ) (serial numbers: NM_001128777 .1, JN991058.1, XM_003457723.1, EU586111.1, AY362186.1), and then use ClustalX 2.0 for sequence alignment. Degenerate primers were designed according to the comparison results, in which the upstream primer LEAP-2-S was [5'- TTCACCCAAAGGAAAGCAGC] (SEQ ID NO.6), and the downstream primer LEAP-2-A was [5'-GTCCCGTGGAGCATTCGTAG] (SEQ ID NO. .7). Finally, the antimicrobial peptide LEAP-2 of the grouper was amplified using the PCR Mix of Guangzhou Dongsheng Biotechnology Co., Ltd. and the liver cDNA of the grouper obtained by reverse transcription of the M-MLV reverse transcriptase kit (Invitrogen, USA) as a template. The middle fragment o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com