Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antimicrobial peptide leap-2 gene, vector, recombinant strain and protein of oblique-banded grouper and its application

A technology of LEAP-2 and grouper antimicrobial peptide, which is applied in the field of genetic engineering, can solve the problems of high morbidity and mortality, achieve strong antibacterial ability, high economic value, and enrich the gene pool

Active Publication Date: 2015-10-28
SOUTH CHINA NORMAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the high morbidity and mortality caused by the current climate disasters and environmental pollution have always been difficult problems in the artificial breeding of grouper
There is no feed additive on the market that can effectively enhance the immunity of grouper or not produce drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antimicrobial peptide leap-2 gene, vector, recombinant strain and protein of oblique-banded grouper and its application
  • Antimicrobial peptide leap-2 gene, vector, recombinant strain and protein of oblique-banded grouper and its application
  • Antimicrobial peptide leap-2 gene, vector, recombinant strain and protein of oblique-banded grouper and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0050] 1. Obtaining the Middle Fragment of the Antimicrobial Peptide LEAP-2 Gene of Scutellaria chinensis by Designing Degenerate Primers

[0051] First search the antimicrobial peptide LEAP-2 gene sequences of zebrafish, large yellow croaker, tilapia, flounder and rainbow trout on NCBI (http: / / www.ncbi.nlm.nih.gov / ) (serial numbers: NM_001128777 .1, JN991058.1, XM_003457723.1, EU586111.1, AY362186.1), and then use ClustalX 2.0 for sequence alignment. Degenerate primers were designed according to the comparison results, in which the upstream primer LEAP-2-S was [5'- TTCACCCAAAGGAAAGCAGC] (SEQ ID NO.6), and the downstream primer LEAP-2-A was [5'-GTCCCGTGGAGCATTCGTAG] (SEQ ID NO. .7). Finally, the antimicrobial peptide LEAP-2 of the grouper was amplified using the PCR Mix of Guangzhou Dongsheng Biotechnology Co., Ltd. and the liver cDNA of the grouper obtained by reverse transcription of the M-MLV reverse transcriptase kit (Invitrogen, USA) as a template. The middle fragment o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Saddletail grouper antimicrobial peptide LEAP-2 gene, vector, recombinant strain and protein, and application thereof. The amino acid sequence of the Saddletail grouper antimicrobial peptide LEAP-2 precursor protein is disclosed as SEQ ID NO.2, or the Saddletail grouper antimicrobial peptide LEAP-2 precursor protein is a protein with identical or higher activity prepared by performing substitution, deletion and / or addition on one or more of amino acids and / or terminal modification on the amino acid sequence disclosed as SEQ ID NO.2. The invention also discloses a Saddletail grouper antimicrobial peptide LEAP-2 gene sequence and a LEAP-2 mature peptide gene mLEAP-2 nucleotide sequence subjected to code modification; and thus, the Saddletail grouper antimicrobial peptide LEAP-2 gene enriches the gene bank of grouper, can be used for preparing a recombinant protein, antimicrobial preparation, fish immune preparation or feed additive, and provides new theoretical and practical basis for physiologic immunity research of grouper.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an antimicrobial peptide LEAP-2 precursor protein, a gene encoding the protein, a carrier containing the gene and its application; also relates to a LEAP-2 mature peptide protein and the protein encoding the protein The gene, the vector containing the gene and its application. Background technique [0002] Antimicrobial peptide is a kind of biologically active natural small molecular polypeptide produced in organisms, which widely exists in various organisms and is an important part of the immune system of organisms. Since Steiner first discovered the existence of antimicrobial peptides in insects in 1981, thousands of antimicrobial peptides have been found in many species so far. At the same time, people also found that antimicrobial peptides can act on G + and G — Bacteria, fungi, parasites and even viruses, and will not harm normal cells and produce ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/46C12N15/12C12N15/81C12N1/19C12P21/02A61K38/17A61P31/04A23K1/17A23K1/18C12R1/84A23K20/195
CPCC07K14/461
Inventor 王维娜谢福星刘媛
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com