Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of TALE aggregate library

A construction method and polymer technology, applied in the field of biology, can solve the problems of unfavorable TALE-related vector construction, slow construction of vector, unfavorable gene editing, etc.

Inactive Publication Date: 2014-05-14
CYAGEN BIOSCI GUANGZHOU
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the construction of vectors by the above two methods is relatively slow, which is not conducive to the construction of high-throughput TALE-related vectors, and is not conducive to large-scale gene editing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of TALE aggregate library
  • Construction method of TALE aggregate library
  • Construction method of TALE aggregate library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0116] Taking the knockout mouse Mapk11 gene as an example, the TALEN targeting site is designed, and the target recognition sequence is located in the second exon.

[0117] The DNA sequence recognized by the left TALE is 5'TCGCCCACCTTGCAGCTCGGCC

[0118] The DNA sequence recognized by the right TALE is 5'TTCTTTACAGCCACCTTCTGGCGC.

[0119] The 0.5repeat that recognizes T and the last base is located on the backbone vector, and we only need to clone the middle sequence into the backbone vector.

[0120] According to the TALE recognition DNA sequence on the left (T) CGCCCACCTTGCAGCTCGGC (C), we can take out TALE-HD1NH2HD3HD4HD5 from the first type pentamer library, and take out the plasmid TALE-NI6HD2HD3NG4NG7 from the second type pentamer library. Take the plasmid TALE-NH8HD2NI3NH4HD9 from the third type of pentamer library, and take out the plasmid TALE-NG10HD2NH3NH4HD11 from the fourth type of pentamer library. Dilute these four plasmids to 20ng / ul respectively, and perform ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of a TALE (Transcription Activator-Like Effector) aggregate library. The method is capable of establishing the TALE aggregate library through TALE monomer amplification, construction of an enzyme-cut and link-up product, amplification of the enzyme-cut and link-up product and BP reaction. With the TALE aggregate library, 20-25 bpTales modules can be assembled and identified, and the identification region is expanded. The method is high in accuracy rate, flexible and high in throughput, and also capable of establishing carriers accurately at high throughput and greatly saving the cost. The method is capable of expanding the identification region, accurately establishing the carriers at high throughput and greatly saving the cost.

Description

technical field [0001] The invention belongs to a construction method in the field of biology, in particular to a construction method of a TALE polymer library. Background technique [0002] TALEN (Transcription Activator-Like (TAL) Effector Nucleases) targeted gene knockout technology is a new molecular biology tool and a major technological breakthrough in the field of gene function research. This technology utilizes the TAL sequence module to construct a recombinant nuclease targeting any nucleic acid target sequence, which can break the target gene at a specific site, thereby knocking out the gene. [0003] The N-terminal and C-terminal of TALE protein are nuclear localization signal (Nuclear localization signal, NLS) and transcriptional activation domain (Activation domain, AD), respectively, while the middle part is the domain that mediates its specific recognition and binding to DNA. The middle part of the TALE protein contains a very long repeating sequence arranged...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B50/06C40B40/02C12N15/70C12N15/66
CPCC12N15/1093
Inventor 王文忠施金秀张玮蒙伟能李春园温华杰
Owner CYAGEN BIOSCI GUANGZHOU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com