Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method of cultivating male sterile plants using a virus-induced gene silencing system

A technology for male sterility and planting, which is applied in botany equipment and methods, genetic engineering, plant genetic improvement, etc., can solve the problems of hybrid sterile plants, restrictions, and increased production costs, and achieve less field work and less time. Short, cost-saving effect

Inactive Publication Date: 2016-05-25
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage of this system is that there are 50% fertile plants in the sterile line, and 50% of the fertile plants in the sterile line must be manually removed during parental reproduction and hybrid production, resulting in increased production costs, and once the infertile lines are removed In time, a proportion of sterile lines will appear in the hybrids
However, the use of VIGS technology to silence plant endogenous genes has always had a problem of silencing efficiency, and the proportion of obtained phenotypic materials is less than 30%, which limits the application of this technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of cultivating male sterile plants using a virus-induced gene silencing system
  • A method of cultivating male sterile plants using a virus-induced gene silencing system
  • A method of cultivating male sterile plants using a virus-induced gene silencing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Construction of VIGS vector for silencing rapeseed COI1 gene

[0040] 1.1 Obtaining the cDNA of the COI1 gene in rape

[0041] Cultivate rape seedlings, and when they grow to about 10cm, extract the total RNA from the stem and cotyledons with the TRIZOL method, obtain the cDNA corresponding to the rape total RNA through reverse transcription, and take a small amount of cDNA as a template. The forward primer is: AAATCTAGAGTGTCTCCGAACCATAGGC, reverse The primers are: TCTCTCACCTCTCCAAGCTG, and a 514 bp cDNA fragment of the rape COI1 gene (SEQ ID NO. 1 (1181) to (1694)) is obtained by PCR amplification.

[0042] 1.2 Obtaining the pTRV2 vector containing the COI1 gene of rape

[0043] The cDNA fragment of COI1 gene was digested with XbaI, and the plasmid pTRV2 was digested with XbaI and EcoICRI. The digestion systems were: 1.5μL Buffer (Buffer3), 1μL XbaI, 5μL COII gene cDNA fragment, supplemented with water to 15μL; 1.5μL Buffer (BufferMultiCore) , 0.5μL Xba1, 0.5μLEcoICRI0.1μL...

Embodiment 2

[0074] 1. Experimental rape seedling sowing, vernalization and seedling cultivation

[0075] Sowing rape Zhongshuang 11, using plastic fiber as the fixation, MS liquid medium as the nutrient, spraying 1 / 500 diluted chlormequat on the stems to about 5cm to inhibit the excessive growth of rape seedlings. Vernalization begins after half a month , Vernalization conditions are 9h during the day, 9℃; 15h at night, 40℃. After 14 days of vernalization, they were recovered at 12°C for 2 days and 9 hours in the day and 15 hours in the night. After resuscitation, they were moved to a greenhouse at 25°C for cultivation.

[0076] 2. Infect rape seedlings with Agrobacterium containing VIGS vector to cultivate rape lines that silence COI1 gene

[0077] 2.1 Agrobacterium preparation for infection

[0078] GV-C, GV-1 and GV-COI1 were added to 6ml YEB medium, 6μLRif, 6μL Kan, and three single bacteria were inoculated, and cultured overnight at 28℃, 220rpm. shaking; then, in 50ml YEB medium Add 50μLR...

Embodiment 3

[0103] The corresponding sequence of tobacco COI1 gene ((444)..(952) of SEQ ID NO.2) was constructed into VIGS vector, and after infecting tobacco, male sterile plants of tobacco were also obtained. Such as Figure 8 As shown, tobacco with the COI1 gene silenced caused infertility due to abnormal stamen development.

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a virus-induced gene silencing (VIGS) carrier system in culturing a dicot male sterile plant. A VIGS-technology-based efficient practical plant sterile strain creation technical system is created, the sterile rate is more than 96% and can be up to 98%, the system has the characteristic of unstable inheritance, the infertility is not inherited in the later generations, and the gene contamination or the problem about biosafety caused by uncontrollable biotechnology diffusion is avoided. Besides, the method is simple to operate, the consumed time is short, the workload in the field is low, the cost is greatly saved, and the breeding efficiency is improved.

Description

Technical field [0001] The invention relates to a carrier system and method for cultivating male sterile plants by means of biotechnology, in particular to dicotyledonous plants. Background technique [0002] Cultivating male sterile lines with stable and thorough sterility and good various traits is the key to achieving the goal of plant hybrid breeding. At present, the main ways to cultivate male sterile lines in production include cytoplasmic sterile system, nuclear sterile system and chemical male sterilization system. [0003] Cytoplasmic male sterility is currently one of the most widely used and most effective ways to utilize the heterosis of rapeseed, but the sterility of the sterile line of this system is not thorough enough and is easily affected by environmental temperature. Micro-pollen is prone to appear under low temperature conditions at the initial flowering stage. The production of micro-powder will force the female parent to self-bred and reduce the recovery of F...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/83A01H5/00
Inventor 张洪博王文静李加纳杨小川马浩然
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com