Primer pair for detecting gardnerella vaginalis, kit and application thereof
A technology of Gardnerella vaginalis and a detection kit, which is applied in the field of disease detection, can solve problems such as increased risk of cervical cancer, low specificity of polyclonal antibodies, and baby health consequences, and achieve effective control of vaginal Gardnerella in the reproductive tract. Effect of Gardnerella infection and timely treatment of genital vaginal Gardnerella infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] In this example, ATAGGCGATTGCGCTTACGAAG (SEQ ID NO: 2) and CACGTCTTCGCTTGCACAAAG (SEQ ID NO: 3) were used as primer pairs to amplify clinical samples.
[0037] (1) PCR amplification reaction
[0038] Prepare 3 PCR reaction tubes, add clinical positive sample DNA and negative control sample respectively, then add 0.1 μL Taq enzyme, 0.8 μL dNTPs (2.5mM), 1 μL PCR buffer (10*PCR buffer), 0.6 μL MgCl 2 (25 μM), 0.1 μL upstream primer (100 μM) and 0.1 μL downstream primer (100 μM), with ddH 2 O to make up to a total volume of 10 μL. Place the PCR tube with the sample added on the PCR instrument, set the PCR reaction parameters (see Table 1), and carry out amplification; after the reaction, use 1% agarose gel for identification, the results are as follows: figure 1 , the sample size result is consistent with the expected size, and the negative result is normal.
[0039] Table 1PCR reaction parameters
[0040]
[0041] (2) Cloning and transformation of PCR products
[...
Embodiment 2
[0046] In this example, ATAGGCGATTGCGCTTACGAAGTTAC (SEQ ID NO: 4) and CACGTCTTCGCTTGCACAAAGAC (SEQ ID NO: 5) were used as primer pairs to amplify clinical samples.
[0047] The system and procedure of Example 1 were used for PCR amplification, and the PCR product was cloned, transformed and identified by sequencing. The fragment length was 219 bp, and the sequence was shown in SEQ ID NO:1.
Embodiment 3
[0049] In this example, GGCGATTGCGCTTACGAAGTTAC (SEQ ID NO: 6) and GTCTTCGCTTGCACAAAGAC (SEQ ID NO: 7) were used as primer pairs to amplify clinical samples.
[0050] The system and procedure of Example 1 were used for PCR amplification, and the PCR product was cloned, transformed and identified by sequencing. The fragment length was 213bp, and the sequence was shown in SEQ ID NO:8.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More