Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitative primer group for visual differential diagnosis of waterfowl circoviruses

A technology of circovirus and differential diagnosis, applied in the direction of microbe-based method, microbe measurement/test, microbiology, etc., to achieve high efficiency and accuracy, and simple identification method

Active Publication Date: 2014-06-25
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there are no relevant research reports at home and abroad that only need a set of real-time fluorescent quantitative PCR primers to simultaneously carry out visual differential diagnosis of DuCV and GoCV infection. The establishment of the present invention can fill in the gaps in related fields at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative primer group for visual differential diagnosis of waterfowl circoviruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Virus strains:

[0030] Both duck circovirus (DuCV) and goose circovirus (GoCV) were identified and preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0031] 2. Primer design and synthesis

[0032] Real-time fluorescence quantitative PCR primers P1 and P2 were designed according to the conserved region of the protein (Rep protein) encoded by ORF-V1 in the DuCV and GoCV genomes, and the sequences of primers P1 and P2 are:

[0033] Upstream primer P1: 5'- TAATAGGGAGCCTCGCGATTGGTA -3',

[0034] Downstream primer P2: 5'- AACCAGGACTTAGTAGTTTATT -3'.

[0035] 3. Real-time fluorescent quantitative PCR amplification

[0036] DuCV and GoCV genomic DNA were extracted by conventional methods. The designed specific real-time fluorescent quantitative PCR primers P1 and P2 were used for real-time fluorescent quantitative PCR amplification.

[0037] The optimized 20 μL optimal reaction system is the system: S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer group for visual detection on infection conditions of duck circovirus (DuCV) and goose circovirus (GoCV) and a method thereof. According to the method, the detection on the infection conditions of DuCV and GoCV is carried out by using dissolution curve temperature Tm value difference caused by the difference between nucleotide GC contents of DuCV and GoCV specific gene fragment regions amplified by primers, and the infection conditions of DuCV and GoCV can be subjected to visual differential diagnosis specifically by only combining the SYBR Green I based real-time fluorescent quantitative PCR primer group to difference of dissolution curve Tm values which are automatically generated after reaction is ended. The method disclosed by the invention is simple and is relatively high in efficiency and accuracy.

Description

technical field [0001] The invention belongs to the field of animal molecular etiology, and in particular relates to a set of fluorescent quantitative primers for visual differential diagnosis of waterfowl circovirus (duck circovirus and goose circovirus). Background technique [0002] Duck infection with circovirus was first reported by Hattermann et al. in 2003 (Hattermann K, Schmitt C, Soike D, et al. Cloning and sequencing of duck circovirus (DuCV). Arch Virol, 2003, 148: 2471-2480.), the earliest in China Fu Guanghua et al. (Fu Guanghua, Cheng Longfei, Huang Yu, et al. Cloning and sequence analysis of the whole genome of duck circovirus. Acta Virology, 2008, 24 (2): 138-143.) reported duck circovirus infection . The clinical manifestations of poultry infected with circovirus are mainly characterized by growth retardation and disheveled feathers, which mainly invade the immune system and cause similar virus-induced lymphoid tissue damage, weakening the humoral and cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12Q1/06C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/686C12Q1/70C12Q2531/113C12Q2563/107C12Q2545/114C12Q2561/113
Inventor 万春和黄瑜陈红梅程龙飞傅光华施少华
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com