Fluorescent quantitative primer group for visual differential diagnosis of waterfowl circoviruses
A technology of circovirus and differential diagnosis, applied in the direction of microbe-based method, microbe measurement/test, microbiology, etc., to achieve high efficiency and accuracy, and simple identification method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Virus strains:
[0030] Both duck circovirus (DuCV) and goose circovirus (GoCV) were identified and preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.
[0031] 2. Primer design and synthesis
[0032] Real-time fluorescence quantitative PCR primers P1 and P2 were designed according to the conserved region of the protein (Rep protein) encoded by ORF-V1 in the DuCV and GoCV genomes, and the sequences of primers P1 and P2 are:
[0033] Upstream primer P1: 5'- TAATAGGGAGCCTCGCGATTGGTA -3',
[0034] Downstream primer P2: 5'- AACCAGGACTTAGTAGTTTATT -3'.
[0035] 3. Real-time fluorescent quantitative PCR amplification
[0036] DuCV and GoCV genomic DNA were extracted by conventional methods. The designed specific real-time fluorescent quantitative PCR primers P1 and P2 were used for real-time fluorescent quantitative PCR amplification.
[0037] The optimized 20 μL optimal reaction system is the system: S...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com