Molecular marker related to yellow chicken feather and application of molecular marker
A molecular marker, yellow technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the problem of lack of rapid identification of genotypes related to chicken yellow feathers, and achieve the effect of improving consistency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] S1. Primer design
[0025] Using the chicken MC1R gene CDS sequence (GenBank accession number: D78272.1) in the NCBI database as a reference, a pair of primers were designed using GeneTool software. The DNA sequence amplified by the primers is shown in SEQ ID NO: 1, with a total length of 1538 bp . Primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd. The primer sequences are as follows:
[0026] MC1R-F: 5'—ATCCCAAGGTACACAGTGAC—3'
[0027] MC1R-R: 5'—GGGCACCCAGGGGACACC—3'
[0028] S2. Screening molecular markers
[0029] S21. The experimental materials are shown in Table 1.
[0030] Table 1 Experimental materials
[0031]
[0032] S22. PCR amplification
[0033] The components in the PCR reaction system with a total volume of 30 μL are shown in Table 2.
[0034] Table 2 PCR reaction system (30μL)
[0035]
[0036] The PCR reaction program was: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap