Molecular marker related to yellow chicken feather and application of molecular marker

A molecular marker, yellow technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the problem of lack of rapid identification of genotypes related to chicken yellow feathers, and achieve the effect of improving consistency

Inactive Publication Date: 2014-07-02
SOUTH CHINA AGRI UNIV
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to provide a molecular marker related to chicken yellow fe

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to yellow chicken feather and application of molecular marker
  • Molecular marker related to yellow chicken feather and application of molecular marker
  • Molecular marker related to yellow chicken feather and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] S1. Primer design

[0025] Using the chicken MC1R gene CDS sequence (GenBank accession number: D78272.1) in the NCBI database as a reference, a pair of primers were designed using GeneTool software. The DNA sequence amplified by the primers is shown in SEQ ID NO: 1, with a total length of 1538 bp . Primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd. The primer sequences are as follows:

[0026] MC1R-F: 5'—ATCCCAAGGTACACAGTGAC—3'

[0027] MC1R-R: 5'—GGGCACCCAGGGGACACC—3'

[0028] S2. Screening molecular markers

[0029] S21. The experimental materials are shown in Table 1.

[0030] Table 1 Experimental materials

[0031]

[0032] S22. PCR amplification

[0033] The components in the PCR reaction system with a total volume of 30 μL are shown in Table 2.

[0034] Table 2 PCR reaction system (30μL)

[0035]

[0036] The PCR reaction program was: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a molecular marker related to yellow chicken feather and an application of the molecular marker. The molecular marker is obtained by A/G base mutation at the 883rd site in a sequence shown by SEQ ID NO:1. The molecular marker is amplified by using primers SEQ ID NO:2 and SEQ ID NO:3, and the obtained amplification product is directly sequenced. The method is simple and convenient in operation and reliable in result. A genotype of the yellow feather trait of a target chicken flock can be determined by detecting the A/G mutation site, and whether the feather color of a certain individual is homozygous yellow feather or heterozygous yellow feather can also be judged through the genotype, so that a basis is provided for purposefully selecting the feather trait of the chicken flock, and the uniformity of the yellow offspring chicken feather is improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker related to chicken yellow feathers and an application thereof. Background technique [0002] The feather color of a chicken is one of the important characteristics of a breed, and it is also an important indicator affecting its economic value. The main pigment that affects chicken feather color is melanin, and melanin can be divided into two types, one is eumelanin, which is brown or black; the other is melanophilic pigment, which is yellow or red. Chicken feather pigmentation depends on the relative amount of eumelanin and melanophilin it contains. Chicken melanin originates from the trunk nerve crest cells of the embryo, and begins to disperse and migrate to the dermis to settle in the dermis during embryogenesis, gradually spreading throughout the body, and most melanocytes gather in the hair follicles (Kerje et al., 2003). [0003] Feather color i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12Q1/68
Inventor 张细权许继国聂庆华吴海清
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap