Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria

A technology of genetically engineered bacteria and exogenous protein, applied in the field of Aspergillus oryzae genetically engineered bacteria, can solve the problems of low expression of exogenous protein, difficult separation and purification, etc., and achieve the effects of stable expression, efficient secretion and expression, and low cost.

Active Publication Date: 2014-08-27
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a kind of expression equipment and its Aspergillus oryzae genetically engineered bacteria for secreting and expressing exogenous protein in Aspergillus oryzae cells, thereby solving the problem of low foreign protein expression in the Aspergillus oryzae filamentous fungus expression system in the prior art Defects of difficult separation and purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria
  • Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria
  • Foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0037] The preparation method of the expression device of the present invention is as follows:

[0038] (1) Through PCR amplification, the promoter of Aspergillus oryzae α-amylase (PamyB+signal peptide, PaS) containing the secretory peptide sequence, an exogenous amylase gene (GpA2), and the terminator of Aspergillus oryzae α-amylase were respectively obtained. The respective DNA sequences of the child (TamyB) and orotate phosphoribosyltransferase gene screening marker expression cassette.

[0039] (2) The fusion sequence (PaSA2) obtained by fusion PCR of the promoter, the signal peptide sequence (PaS) and the amylase gene (GpA2), the terminator (TamyB), orotate phosphoribosyltransferase gene screening marker expression cassette , PaSA2 were sequentially connected to the expression vector pBC-Hygro, and the recombinant expression vector 1 was constructed, namely pBC12FA2; the expression vector 2, namely pBC12NHA2, was obtained by inserting the 6×His-Tag purification tag throug...

Embodiment 1

[0068] Embodiment 1. comprises the construction of the expression vector of Aspergillus oryzae expression equipment of the present invention

[0069] 1.1. Extraction of Aspergillus oryzae genome

[0070] Aspergillus oryzae RIB40 (National Research Institute of Brewing Stock Culture, ATCC42149) was inoculated on CM medium and cultured at 30°C for 7 days until the spores matured. Prepare an appropriate amount of spore suspension and inoculate it in CM medium liquid seed medium, and cultivate it at 30°C and 200rpm for 2 days until the mycelium concentration reaches 4-5g / L for genome extraction. The method refers to the instructions of the Omega fungal genome extraction kit. .

[0071] 1.2. Isolation of Aspergillus oryzae α-amylase promoter (PamyB) and its signal peptide sequence

[0072] According to the sequence of the amyB promoter published on GeneBank, using the above-mentioned extracted Aspergillus oryzae genomic DNA as a template, specific PCR amplification was performed ...

Embodiment 2

[0111] Embodiment 2. Utilize Aspergillus oryzae expression equipment to express green fluorescent protein

[0112] 2.1. Amplification of the green fluorescent protein gene

[0113] Using the plasmid pMD19-T simple vector linked to the green fluorescent protein GFP (NCBI GenBank accession number: AY013824) as a template, the 717bp (including restriction site) enhanced green was amplified by PCR using primers GFPNf / GFPHr fluorescent protein gene. The primer sequences are:

[0114] GFPNf: CACTA GCTAGC ATGAGTAAAGGAGAAGAAC, which contains the NheI restriction site;

[0115] GFPHr: CCC AAGCTT TTATTTGTATAGTTCATCCATG, which contains the HindIII restriction site.

[0116] The length of the amplified product and the results of sequence analysis were in line with expectations.

[0117] 2.2. Connection between GFP and expression equipment

[0118]The above-mentioned amplified product (GFP gene) was digested with NheI and HindIII restriction enzymes, and connected to the express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a foreign protein expression device used for secretory expression in Aspergillus oryzae cells and Aspergillus oryzae genetically engineered bacteria. From 5' to 3', the expressin device sequentially comprises a promoter for controlling foreign genes to transcribe in Aspergillus oryzae, a coding sequence of signal peptides for controlling secretory expression of foreign genes in the Aspergillus oryzae, a coding sequence of labels used for performing affinity purification on the foreign genes , a multiple-cloning site, a terminator for controlling the foreign genes to terminate transcribing in the a Aspergillus oryzae and an expression box of Aspergillus oryzae ribose phosphate transferase genes for performing plasmid transformation on selection markers. The coding sequence is as shown by SEQ ID No:2. According to the expression device, the auxotroph gene selection markers are used, so that the transformation positive rate is increased, operation time is shortened, workloads are reduced, and the expression device is suitable for secretory expression of most of foreign genes; the Aspergillus oryzae genetically engineered bacteria can efficiently express acid and neutral amylase and is important in application to the paper industry and the textile industry.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to an expression device for exogenous protein secreted and expressed in Aspergillus oryzae cells and an Aspergillus oryzae genetically engineered bacterium. Background technique [0002] Aspergillus oryzae (Aspergillus oryzae) is a commonly used strain in the fermentation industry. Mycelium is generally yellow-green, then yellowish brown; Aspergillus oryzae mycelium is composed of multi-cells and is a strain that produces complex enzymes. In addition to protease, it can also be used to secrete amylase, cellulase, pectinase, glycoside enzymes, lipases, peptidases, and phytases; among them, the industrially common peak amylase (TAA) is the α-amylase derived from Aspergillus oryzae. Aspergillus oryzae is a safe microorganism (GRAS) recognized by the FDA. It is widely used in brewing, condiment, feed manufacturing, textile, paper, pulp and other industrial fields, and has b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/80C12N1/15C12P21/00C12R1/69
Inventor 魏东芝高蓓毛佑志
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com