An expression device for secreting and expressing foreign protein in Aspergillus oryzae cells and its genetic engineering bacteria of Aspergillus oryzae
A technology for genetically engineered bacteria and exogenous proteins, applied in the field of Aspergillus oryzae genetically engineered bacteria, can solve the problems of low expression of exogenous proteins, difficulty in separation and purification, etc., and achieve the effects of stable expression, efficient secretion and expression, and easy separation and purification.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0037] The preparation method of the expression device of the present invention is as follows:
[0038] (1) Through PCR amplification, the promoter of Aspergillus oryzae α-amylase (PamyB+signal peptide, PaS) containing the secretory peptide sequence, an exogenous amylase gene (GpA2), and the terminator of Aspergillus oryzae α-amylase were respectively obtained. The respective DNA sequences of the child (TamyB) and orotate phosphoribosyltransferase gene screening marker expression cassette.
[0039] (2) The fusion sequence (PaSA2) obtained by fusion PCR of the promoter, the signal peptide sequence (PaS) and the amylase gene (GpA2), the terminator (TamyB), orotate phosphoribosyltransferase gene screening marker expression cassette , PaSA2 were sequentially connected to the expression vector pBC-Hygro, and the recombinant expression vector 1 was constructed, namely pBC12FA2; the expression vector 2, namely pBC12NHA2, was obtained by inserting the 6×His-Tag purification tag throug...
Embodiment 1
[0068] Embodiment 1. comprises the construction of the expression vector of Aspergillus oryzae expression equipment of the present invention
[0069] 1.1. Extraction of Aspergillus oryzae genome
[0070] Aspergillus oryzae RIB40 (National Research Institute of Brewing Stock Culture, ATCC42149) was inoculated on CM medium, and incubated at 30°C for 7 days until the spores matured. Prepare an appropriate amount of spore suspension and inoculate it in CM medium liquid seed medium, and cultivate it at 30°C and 200rpm for 2 days until the mycelium concentration reaches 4-5g / L for genome extraction. The method refers to the instructions of the Omega fungal genome extraction kit. .
[0071] 1.2. Isolation of Aspergillus oryzae α-amylase promoter (PamyB) and its signal peptide sequence
[0072] According to the sequence of the amyB promoter released on GeneBank, the above-mentioned extracted Aspergillus oryzae genomic DNA was used as a template, and the upstream primer PaXf and the ...
Embodiment 2
[0111] Embodiment 2. Utilize Aspergillus oryzae expression equipment to express green fluorescent protein
[0112] 2.1. Amplification of the green fluorescent protein gene
[0113] Using the plasmid pMD19-T simple vector linked to the green fluorescent protein GFP (NCBI GenBank accession number: AY013824) as a template, the 717bp (including restriction site) enhanced green was amplified by PCR using primers GFPNf / GFPHr fluorescent protein gene. The primer sequences are:
[0114] GFPNf: CACTA GCTAGC ATGAGTAAAGGAGAAGAAC, which contains the NheI restriction site;
[0115] GFPHr: CCC AAGCTT TTATTTGTATAGTTCATCCATG, which contains the HindIII restriction site.
[0116] The length of the amplified product and the results of sequence analysis were in line with expectations.
[0117] 2.2. Connection between GFP and expression equipment
[0118] The above-mentioned amplified product (GFP gene) was digested with NheI and HindIII restriction enzymes, and connected to the expres...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


