Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Shuttle plasmid vector, as well as construction method and applications thereof

A shuttle plasmid and construction method technology, applied in the direction of using vectors to introduce foreign genetic material, DNA preparation, recombinant DNA technology, etc., can solve the problems of unstable yeast artificial chromosome plasmids, insufficient quality and quantity, etc.

Active Publication Date: 2014-10-08
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the yeast artificial chromosome plasmid is unstable in yeast cells, the quality and quantity of the plasmid DNA obtained by separation and purification through agarose gel cannot meet the requirements of later stage molecular biology and cytology experiments; therefore, a kind of A shuttle plasmid vector capable of shuttling between yeast and bacteria, capable of recombination cloning, self-replication, recombinant selection in yeast, and stable replication and storage in bacteria, facilitating DNA purification and isolation is a person skilled in the art A technical problem to be solved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shuttle plasmid vector, as well as construction method and applications thereof
  • Shuttle plasmid vector, as well as construction method and applications thereof
  • Shuttle plasmid vector, as well as construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] For the construction method of this shuttle plasmid vector provided by the embodiment of the present invention, please refer to figure 2 , including the following steps:

[0030] Step 101: Using the cosmid pRS313 vector as a template, PCR is performed by setting primers to obtain the HIS3 screening element whose nucleotide sequence is shown in SEQ ID NO.2;

[0031] In step 101, according to the nucleotide sequence information on GenBank (U03439) combined with the information of the cosmid pRS313, specific primers are set, and the HIS3 screening element is obtained by PCR operation; its sequence is shown in SEQ ID NO.2.

[0032] Step 102: Synthesizing the CEN6-ARSH4 yeast replication sequence, and introducing restriction endonuclease sites BamH I and EcoR I at its two ends, and then ligating it into the pUC19 plasmid;

[0033] Step 103: The pUC19 plasmid containing the CEN6-ARSH4 yeast replication sequence is double-digested with BamH I and EcoR I to obtain the CEN6-AR...

Embodiment 2

[0042] In this embodiment, the preparation method of the shuttle plasmid vector comprises the following steps:

[0043] S1: Consistent with the above step 101, specifically, the primers used are YF1 and YR1, and their nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 in turn.

[0044] Specifically, primers YF1 and YR1 (the first 23 bp of the upstream primer YF1 is homologous to the terminal sequence of the yeast replication element CEN6-ARSH4, as shown in the bold underlined part below).

[0045] YF1: GTTACAGGCAAGCGATCCGTCCG GAAACCATTATTATCATGACATTAACCT;

[0046] YR1: TCCCCCGGGACGCATCTGTGCGGTATTTC.

[0047] The specific conditions for PCR are:

[0048] The total reaction volume is 25 μl: including 10×KOD-PLUS buffer 2.5 μl; 2mM dNTPs 2.5 μl; 25 mM MgSO4 1.2 μl; template pRS3131 μl; primer YF11 μl; primer YR11 μl; KOD-PLUS polymerase 0.5 μl; ddH 2 O15.3μl; the reaction program is: 94°C 2min; 94°C 15sec, 59°C 25sec, 68°C 2min, 30 cycles; 68°C 5min extension; 4°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biotechnology, and particularly relates to a shuttle plasmid vector, as well as a construction method and applications thereof. The shuttle plasmid vector can shuttle in yeast and Escherichia coli, and the nucleotide sequence of the shuttle plasmid vector is shown in SEQ ID NO.1. Compared with the prior art, he shuttle plasmid vector realizes the shuttling in yeast and bacteria, and has the capabilities of homologous recombination cloning, self replication and recombinant screening in yeast, as well as the characteristics of being stable in replication and maintenance and convenient for DNA purification and separation in bacteria.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a shuttle plasmid vector and its construction method and application. Background technique [0002] Since the process of cell life involves complex physiological and biochemical reactions, in most cases it is controlled by multiple genes or gene clusters, and these regulations are often closely related to the genetic information of hundreds or even thousands of kb of DNA fragments. In order to better understand these To analyze the functions of genes or gene clusters, and to study the biological laws and significance in the phenomenon of cell life, this requires new technologies to selectively isolate or artificially synthesize and transform some genomic DNA fragments larger than 20kb, so as to comprehensively accelerate genomics and The research progress of genome functional segments. [0003] At present, the polymerase chain reaction (PCR) is the most direct and effective technica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/66C12N15/10
Inventor 肖庚富侯政周拯王宗林王薇
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com