Shuttle plasmid vector, as well as construction method and applications thereof
A shuttle plasmid and construction method technology, applied in the direction of using vectors to introduce foreign genetic material, DNA preparation, recombinant DNA technology, etc., can solve the problems of unstable yeast artificial chromosome plasmids, insufficient quality and quantity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] For the construction method of this shuttle plasmid vector provided by the embodiment of the present invention, please refer to figure 2 , including the following steps:
[0030] Step 101: Using the cosmid pRS313 vector as a template, PCR is performed by setting primers to obtain the HIS3 screening element whose nucleotide sequence is shown in SEQ ID NO.2;
[0031] In step 101, according to the nucleotide sequence information on GenBank (U03439) combined with the information of the cosmid pRS313, specific primers are set, and the HIS3 screening element is obtained by PCR operation; its sequence is shown in SEQ ID NO.2.
[0032] Step 102: Synthesizing the CEN6-ARSH4 yeast replication sequence, and introducing restriction endonuclease sites BamH I and EcoR I at its two ends, and then ligating it into the pUC19 plasmid;
[0033] Step 103: The pUC19 plasmid containing the CEN6-ARSH4 yeast replication sequence is double-digested with BamH I and EcoR I to obtain the CEN6-AR...
Embodiment 2
[0042] In this embodiment, the preparation method of the shuttle plasmid vector comprises the following steps:
[0043] S1: Consistent with the above step 101, specifically, the primers used are YF1 and YR1, and their nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 in turn.
[0044] Specifically, primers YF1 and YR1 (the first 23 bp of the upstream primer YF1 is homologous to the terminal sequence of the yeast replication element CEN6-ARSH4, as shown in the bold underlined part below).
[0045] YF1: GTTACAGGCAAGCGATCCGTCCG GAAACCATTATTATCATGACATTAACCT;
[0046] YR1: TCCCCCGGGACGCATCTGTGCGGTATTTC.
[0047] The specific conditions for PCR are:
[0048] The total reaction volume is 25 μl: including 10×KOD-PLUS buffer 2.5 μl; 2mM dNTPs 2.5 μl; 25 mM MgSO4 1.2 μl; template pRS3131 μl; primer YF11 μl; primer YR11 μl; KOD-PLUS polymerase 0.5 μl; ddH 2 O15.3μl; the reaction program is: 94°C 2min; 94°C 15sec, 59°C 25sec, 68°C 2min, 30 cycles; 68°C 5min extension; 4°C...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 